Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637953_at:

>probe:Drosophila_2:1637953_at:316:129; Interrogation_Position=2164; Antisense; ACCGAGTACGGCGAGGCGTTCTTCG
>probe:Drosophila_2:1637953_at:479:327; Interrogation_Position=2179; Antisense; GCGTTCTTCGAGACGGCCATTGGCA
>probe:Drosophila_2:1637953_at:230:615; Interrogation_Position=2209; Antisense; TGCACGGAAGAGTCTACCGGCTCTT
>probe:Drosophila_2:1637953_at:530:577; Interrogation_Position=2235; Antisense; GGCGCCATTTGGTCAGATTCAGCTG
>probe:Drosophila_2:1637953_at:227:617; Interrogation_Position=2258; Antisense; TGCAGTTCATAGAGCGGATCCGCCA
>probe:Drosophila_2:1637953_at:104:449; Interrogation_Position=2274; Antisense; GATCCGCCAGATCCATCATATCAAT
>probe:Drosophila_2:1637953_at:642:447; Interrogation_Position=2319; Antisense; GATCCATCGGATCCAACAGAACCAA
>probe:Drosophila_2:1637953_at:538:101; Interrogation_Position=2373; Antisense; AGAGATCCAACAGCGACAGCAGTTC
>probe:Drosophila_2:1637953_at:464:671; Interrogation_Position=2517; Antisense; TACGCGCAGCTTTTCATCGGAGATG
>probe:Drosophila_2:1637953_at:383:349; Interrogation_Position=2564; Antisense; GCAGGACATTACTGGGACATCGCCA
>probe:Drosophila_2:1637953_at:347:329; Interrogation_Position=2660; Antisense; GCGGACGCAAGCCAAATCGTGGTCT
>probe:Drosophila_2:1637953_at:217:495; Interrogation_Position=2681; Antisense; GTCTAAAGGTTGCAAAGCGTCGCTT
>probe:Drosophila_2:1637953_at:101:501; Interrogation_Position=2721; Antisense; GTCGGAGCGCCAAGATAGTGACTCT
>probe:Drosophila_2:1637953_at:132:677; Interrogation_Position=2736; Antisense; TAGTGACTCTGATGGGCGTTTTTGC

Paste this into a BLAST search page for me
ACCGAGTACGGCGAGGCGTTCTTCGGCGTTCTTCGAGACGGCCATTGGCATGCACGGAAGAGTCTACCGGCTCTTGGCGCCATTTGGTCAGATTCAGCTGTGCAGTTCATAGAGCGGATCCGCCAGATCCGCCAGATCCATCATATCAATGATCCATCGGATCCAACAGAACCAAAGAGATCCAACAGCGACAGCAGTTCTACGCGCAGCTTTTCATCGGAGATGGCAGGACATTACTGGGACATCGCCAGCGGACGCAAGCCAAATCGTGGTCTGTCTAAAGGTTGCAAAGCGTCGCTTGTCGGAGCGCCAAGATAGTGACTCTTAGTGACTCTGATGGGCGTTTTTGC

Full Affymetrix probeset data:

Annotations for 1637953_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime