FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637954_at:

>probe:Drosophila_2:1637954_at:284:205; Interrogation_Position=1014; Antisense; AAGCGCGACCGCTCGATGGCCGACT
>probe:Drosophila_2:1637954_at:661:387; Interrogation_Position=1221; Antisense; GAAAAGTAGTTGTGCCATATCCAAA
>probe:Drosophila_2:1637954_at:481:599; Interrogation_Position=1281; Antisense; TGTACATAACGCACCTATTACCAGT
>probe:Drosophila_2:1637954_at:172:477; Interrogation_Position=1304; Antisense; GTTTCAAACTGATCCATTCGACCTT
>probe:Drosophila_2:1637954_at:106:449; Interrogation_Position=1314; Antisense; GATCCATTCGACCTTTCTAACTTAT
>probe:Drosophila_2:1637954_at:581:77; Interrogation_Position=765; Antisense; AGGATTGTGCCCACAGGCACGGCCT
>probe:Drosophila_2:1637954_at:597:593; Interrogation_Position=790; Antisense; TGGGCAATGCCCTGGAGCTGGCCAC
>probe:Drosophila_2:1637954_at:257:451; Interrogation_Position=852; Antisense; GATCGCAACTCGGTCTACTCGAGCA
>probe:Drosophila_2:1637954_at:57:669; Interrogation_Position=867; Antisense; TACTCGAGCACGTTCGAGACCTCAA
>probe:Drosophila_2:1637954_at:324:103; Interrogation_Position=883; Antisense; AGACCTCAACGTTCCACCAGGCGGT
>probe:Drosophila_2:1637954_at:428:57; Interrogation_Position=913; Antisense; ATGAGGTGATGTTCACGTCCCGTGA
>probe:Drosophila_2:1637954_at:333:229; Interrogation_Position=967; Antisense; AATGGTTCAACCAGACCTTCAAGCC
>probe:Drosophila_2:1637954_at:334:711; Interrogation_Position=984; Antisense; TTCAAGCCGGACACCACGCATTCGT
>probe:Drosophila_2:1637954_at:678:135; Interrogation_Position=999; Antisense; ACGCATTCGTGGCTAAAGCGCGACC

Paste this into a BLAST search page for me
AAGCGCGACCGCTCGATGGCCGACTGAAAAGTAGTTGTGCCATATCCAAATGTACATAACGCACCTATTACCAGTGTTTCAAACTGATCCATTCGACCTTGATCCATTCGACCTTTCTAACTTATAGGATTGTGCCCACAGGCACGGCCTTGGGCAATGCCCTGGAGCTGGCCACGATCGCAACTCGGTCTACTCGAGCATACTCGAGCACGTTCGAGACCTCAAAGACCTCAACGTTCCACCAGGCGGTATGAGGTGATGTTCACGTCCCGTGAAATGGTTCAACCAGACCTTCAAGCCTTCAAGCCGGACACCACGCATTCGTACGCATTCGTGGCTAAAGCGCGACC

Full Affymetrix probeset data:

Annotations for 1637954_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720