FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637958_at:

>probe:Drosophila_2:1637958_at:464:379; Interrogation_Position=2601; Antisense; GAAGCCCCACGAAGAGAGATCCATC
>probe:Drosophila_2:1637958_at:411:427; Interrogation_Position=2616; Antisense; GAGATCCATCCTGGTGGACTTCCAA
>probe:Drosophila_2:1637958_at:354:275; Interrogation_Position=2634; Antisense; CTTCCAACTGTGTCGATATAGCCCA
>probe:Drosophila_2:1637958_at:668:305; Interrogation_Position=2659; Antisense; CCTGCCATGGATTTTCATCTGGTTA
>probe:Drosophila_2:1637958_at:399:105; Interrogation_Position=2738; Antisense; AGACGTACTATGACGCATTGGCTGA
>probe:Drosophila_2:1637958_at:96:63; Interrogation_Position=2776; Antisense; ATGGGTGTCAATCCTTATCAAGAGC
>probe:Drosophila_2:1637958_at:199:421; Interrogation_Position=2821; Antisense; GAGCAGTCTCTCAATGACTTTTCCT
>probe:Drosophila_2:1637958_at:559:403; Interrogation_Position=2836; Antisense; GACTTTTCCTTATTCGGAGCCACTT
>probe:Drosophila_2:1637958_at:419:415; Interrogation_Position=2852; Antisense; GAGCCACTTACAATTGCATAGCCGC
>probe:Drosophila_2:1637958_at:282:633; Interrogation_Position=2885; Antisense; TCCGCCTGCCCGATAATTATCTGAA
>probe:Drosophila_2:1637958_at:318:1; Interrogation_Position=2921; Antisense; ATGAACGACCGGAGGACTTCCATCG
>probe:Drosophila_2:1637958_at:394:271; Interrogation_Position=2941; Antisense; CATCGCTTCTGCAATGTGGATCGAA
>probe:Drosophila_2:1637958_at:569:401; Interrogation_Position=3046; Antisense; GACTATTACCTCAACTGCGATCGGA
>probe:Drosophila_2:1637958_at:10:425; Interrogation_Position=3115; Antisense; GAGACCATTATGACGCCTATCAGGG

Paste this into a BLAST search page for me
GAAGCCCCACGAAGAGAGATCCATCGAGATCCATCCTGGTGGACTTCCAACTTCCAACTGTGTCGATATAGCCCACCTGCCATGGATTTTCATCTGGTTAAGACGTACTATGACGCATTGGCTGAATGGGTGTCAATCCTTATCAAGAGCGAGCAGTCTCTCAATGACTTTTCCTGACTTTTCCTTATTCGGAGCCACTTGAGCCACTTACAATTGCATAGCCGCTCCGCCTGCCCGATAATTATCTGAAATGAACGACCGGAGGACTTCCATCGCATCGCTTCTGCAATGTGGATCGAAGACTATTACCTCAACTGCGATCGGAGAGACCATTATGACGCCTATCAGGG

Full Affymetrix probeset data:

Annotations for 1637958_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720