FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637959_at:

>probe:Drosophila_2:1637959_at:292:729; Interrogation_Position=1010; Antisense; TTGGTCCAGCAAAACTCTGCCTATC
>probe:Drosophila_2:1637959_at:453:279; Interrogation_Position=1064; Antisense; CTACGTCACCGTCTGCGAGGTGATA
>probe:Drosophila_2:1637959_at:237:423; Interrogation_Position=1095; Antisense; GAGAAGGCGCGCTGGCACTCGAACT
>probe:Drosophila_2:1637959_at:330:135; Interrogation_Position=1127; Antisense; ACGCTGGGCGGGATTTGCACAGTTT
>probe:Drosophila_2:1637959_at:568:89; Interrogation_Position=1147; Antisense; AGTTTGCAACTGTGCTCGCCGGCTT
>probe:Drosophila_2:1637959_at:517:571; Interrogation_Position=1167; Antisense; GGCTTTGCGACCATGTGCATCATAA
>probe:Drosophila_2:1637959_at:384:423; Interrogation_Position=1231; Antisense; GAGAAATCGTTTCAGCGCTGTGAGA
>probe:Drosophila_2:1637959_at:335:299; Interrogation_Position=1246; Antisense; CGCTGTGAGAAAATGTGCCGCTTTT
>probe:Drosophila_2:1637959_at:667:3; Interrogation_Position=1302; Antisense; ATTGGCAGCTGTTAATCTCTTGTGT
>probe:Drosophila_2:1637959_at:582:361; Interrogation_Position=1329; Antisense; GACTTGTTACTTGTGCATTTCCAAC
>probe:Drosophila_2:1637959_at:621:489; Interrogation_Position=1368; Antisense; GTACATTGTCGATCTGCCGTAGGAT
>probe:Drosophila_2:1637959_at:490:171; Interrogation_Position=1399; Antisense; AAAGTTCAGTCTTCTCGTCTACATT
>probe:Drosophila_2:1637959_at:309:569; Interrogation_Position=1514; Antisense; GGCATCCTCTTTTCCTTTTGATTAA
>probe:Drosophila_2:1637959_at:539:581; Interrogation_Position=974; Antisense; TGGCCTGGGCATGCTTATCGTGGAC

Paste this into a BLAST search page for me
TTGGTCCAGCAAAACTCTGCCTATCCTACGTCACCGTCTGCGAGGTGATAGAGAAGGCGCGCTGGCACTCGAACTACGCTGGGCGGGATTTGCACAGTTTAGTTTGCAACTGTGCTCGCCGGCTTGGCTTTGCGACCATGTGCATCATAAGAGAAATCGTTTCAGCGCTGTGAGACGCTGTGAGAAAATGTGCCGCTTTTATTGGCAGCTGTTAATCTCTTGTGTGACTTGTTACTTGTGCATTTCCAACGTACATTGTCGATCTGCCGTAGGATAAAGTTCAGTCTTCTCGTCTACATTGGCATCCTCTTTTCCTTTTGATTAATGGCCTGGGCATGCTTATCGTGGAC

Full Affymetrix probeset data:

Annotations for 1637959_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720