FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637960_at:

>probe:Drosophila_2:1637960_at:462:225; Interrogation_Position=441; Antisense; AAGGCAAACGCTGCGGCCAAAGCTG
>probe:Drosophila_2:1637960_at:696:173; Interrogation_Position=459; Antisense; AAAGCTGCCGAAGCAGTGCTGTTCG
>probe:Drosophila_2:1637960_at:455:605; Interrogation_Position=562; Antisense; TGATCACCGCCGAGTCGAATGCACA
>probe:Drosophila_2:1637960_at:165:637; Interrogation_Position=576; Antisense; TCGAATGCACAGCTTGCCGCCAAGA
>probe:Drosophila_2:1637960_at:313:213; Interrogation_Position=597; Antisense; AAGACGCACCAATTGGTCCAGCAGG
>probe:Drosophila_2:1637960_at:595:503; Interrogation_Position=612; Antisense; GTCCAGCAGGAGCTCAAGACACTGA
>probe:Drosophila_2:1637960_at:450:397; Interrogation_Position=629; Antisense; GACACTGACCATAAGCCTCAAGTTG
>probe:Drosophila_2:1637960_at:295:547; Interrogation_Position=668; Antisense; GGATGCCTCAGATCAAGTATACACA
>probe:Drosophila_2:1637960_at:186:159; Interrogation_Position=688; Antisense; ACACAGTGTGGCAACAATCGCTCGC
>probe:Drosophila_2:1637960_at:614:407; Interrogation_Position=719; Antisense; GACGGCACTATTAGAGGCTGCCCAG
>probe:Drosophila_2:1637960_at:500:307; Interrogation_Position=740; Antisense; CCAGCGGCGGGTTAATGTCCTAATG
>probe:Drosophila_2:1637960_at:382:231; Interrogation_Position=761; Antisense; AATGCGGCAACTTAGCGAAGCTCGA
>probe:Drosophila_2:1637960_at:662:69; Interrogation_Position=841; Antisense; AGGCCAAACAGCGTATAGATCAATC
>probe:Drosophila_2:1637960_at:578:561; Interrogation_Position=923; Antisense; GGAACACCATTGATATACCATATAT

Paste this into a BLAST search page for me
AAGGCAAACGCTGCGGCCAAAGCTGAAAGCTGCCGAAGCAGTGCTGTTCGTGATCACCGCCGAGTCGAATGCACATCGAATGCACAGCTTGCCGCCAAGAAAGACGCACCAATTGGTCCAGCAGGGTCCAGCAGGAGCTCAAGACACTGAGACACTGACCATAAGCCTCAAGTTGGGATGCCTCAGATCAAGTATACACAACACAGTGTGGCAACAATCGCTCGCGACGGCACTATTAGAGGCTGCCCAGCCAGCGGCGGGTTAATGTCCTAATGAATGCGGCAACTTAGCGAAGCTCGAAGGCCAAACAGCGTATAGATCAATCGGAACACCATTGATATACCATATAT

Full Affymetrix probeset data:

Annotations for 1637960_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720