FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637961_at:

>probe:Drosophila_2:1637961_at:705:571; Interrogation_Position=1020; Antisense; GGCTCCCTCGATGAATCTGTCGTGG
>probe:Drosophila_2:1637961_at:596:575; Interrogation_Position=1045; Antisense; GGCGAGCCTGCTGCCAAGTCGAGAA
>probe:Drosophila_2:1637961_at:200:473; Interrogation_Position=1078; Antisense; GTTAATCACATGAACCCGTGCGTAA
>probe:Drosophila_2:1637961_at:142:617; Interrogation_Position=1096; Antisense; TGCGTAACCTCCTACAATTATCCCA
>probe:Drosophila_2:1637961_at:271:499; Interrogation_Position=1186; Antisense; GTCTCTGGCCCTTGGACGAAAAATT
>probe:Drosophila_2:1637961_at:1:377; Interrogation_Position=715; Antisense; GAAGCATCAACCAACAACGGCATGT
>probe:Drosophila_2:1637961_at:293:295; Interrogation_Position=750; Antisense; CGACCTCAGCGAGATCTTGGAGCAT
>probe:Drosophila_2:1637961_at:435:419; Interrogation_Position=769; Antisense; GAGCATCTGGCTCAAACTACAGCTG
>probe:Drosophila_2:1637961_at:398:113; Interrogation_Position=805; Antisense; AGCACTGCCACATCTAGCACAGGAA
>probe:Drosophila_2:1637961_at:524:111; Interrogation_Position=820; Antisense; AGCACAGGAACATCTACCAACTCGG
>probe:Drosophila_2:1637961_at:190:141; Interrogation_Position=878; Antisense; ACGTGGATTTGGTTCTGCAGAGCAT
>probe:Drosophila_2:1637961_at:121:569; Interrogation_Position=930; Antisense; GGCTTGGTCCAAGTCTAAATCCGCG
>probe:Drosophila_2:1637961_at:307:493; Interrogation_Position=977; Antisense; GGCATCCCAGTTCCCAAAGTCAGGT
>probe:Drosophila_2:1637961_at:152:219; Interrogation_Position=993; Antisense; AAGTCAGGTCCCCACGAGCGTGCAT

Paste this into a BLAST search page for me
GGCTCCCTCGATGAATCTGTCGTGGGGCGAGCCTGCTGCCAAGTCGAGAAGTTAATCACATGAACCCGTGCGTAATGCGTAACCTCCTACAATTATCCCAGTCTCTGGCCCTTGGACGAAAAATTGAAGCATCAACCAACAACGGCATGTCGACCTCAGCGAGATCTTGGAGCATGAGCATCTGGCTCAAACTACAGCTGAGCACTGCCACATCTAGCACAGGAAAGCACAGGAACATCTACCAACTCGGACGTGGATTTGGTTCTGCAGAGCATGGCTTGGTCCAAGTCTAAATCCGCGGGCATCCCAGTTCCCAAAGTCAGGTAAGTCAGGTCCCCACGAGCGTGCAT

Full Affymetrix probeset data:

Annotations for 1637961_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720