Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637962_at:

>probe:Drosophila_2:1637962_at:88:577; Interrogation_Position=2331; Antisense; GGCCCCGACGCACAAGTATTTGATC
>probe:Drosophila_2:1637962_at:26:483; Interrogation_Position=2346; Antisense; GTATTTGATCGTTTTTCTGTGAGCA
>probe:Drosophila_2:1637962_at:510:605; Interrogation_Position=2351; Antisense; TGATCGTTTTTCTGTGAGCACACTG
>probe:Drosophila_2:1637962_at:390:421; Interrogation_Position=2366; Antisense; GAGCACACTGCTAACCTAGATCGAT
>probe:Drosophila_2:1637962_at:434:137; Interrogation_Position=2372; Antisense; ACTGCTAACCTAGATCGATTAATTA
>probe:Drosophila_2:1637962_at:398:245; Interrogation_Position=2396; Antisense; AATTTTTATGATTTTGTATGACGCA
>probe:Drosophila_2:1637962_at:455:483; Interrogation_Position=2411; Antisense; GTATGACGCAAGCAAAGCCCTAGAA
>probe:Drosophila_2:1637962_at:500:357; Interrogation_Position=2422; Antisense; GCAAAGCCCTAGAAAAATCGAGTGA
>probe:Drosophila_2:1637962_at:362:387; Interrogation_Position=2449; Antisense; GAAAAGTTACCAATTATCGCACTAA
>probe:Drosophila_2:1637962_at:511:475; Interrogation_Position=2454; Antisense; GTTACCAATTATCGCACTAAGATCA
>probe:Drosophila_2:1637962_at:579:515; Interrogation_Position=2506; Antisense; GTGTGGGCCGAAGTAGCAAATAACA
>probe:Drosophila_2:1637962_at:537:707; Interrogation_Position=2539; Antisense; TTGACGATCGGTTGAGGAGGCACTC
>probe:Drosophila_2:1637962_at:574:567; Interrogation_Position=2557; Antisense; GGCACTCAAGCACACACAATGAACC
>probe:Drosophila_2:1637962_at:594:357; Interrogation_Position=2566; Antisense; GCACACACAATGAACCACACAAATA

Paste this into a BLAST search page for me
GGCCCCGACGCACAAGTATTTGATCGTATTTGATCGTTTTTCTGTGAGCATGATCGTTTTTCTGTGAGCACACTGGAGCACACTGCTAACCTAGATCGATACTGCTAACCTAGATCGATTAATTAAATTTTTATGATTTTGTATGACGCAGTATGACGCAAGCAAAGCCCTAGAAGCAAAGCCCTAGAAAAATCGAGTGAGAAAAGTTACCAATTATCGCACTAAGTTACCAATTATCGCACTAAGATCAGTGTGGGCCGAAGTAGCAAATAACATTGACGATCGGTTGAGGAGGCACTCGGCACTCAAGCACACACAATGAACCGCACACACAATGAACCACACAAATA

Full Affymetrix probeset data:

Annotations for 1637962_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime