FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637963_at:

>probe:Drosophila_2:1637963_at:290:439; Interrogation_Position=304; Antisense; GAGGCGGCAGCACGATTAAGATCAT
>probe:Drosophila_2:1637963_at:347:453; Interrogation_Position=323; Antisense; GATCATCAAGGTGATCACCGATTCC
>probe:Drosophila_2:1637963_at:651:305; Interrogation_Position=427; Antisense; CCTCCGGTGGTTACAGTGGCGGCCA
>probe:Drosophila_2:1637963_at:27:123; Interrogation_Position=501; Antisense; AGCGGTGGCAACGTCAAGATCATCA
>probe:Drosophila_2:1637963_at:323:31; Interrogation_Position=522; Antisense; ATCAAGGTCATCTCCGACGCCGGAT
>probe:Drosophila_2:1637963_at:351:519; Interrogation_Position=589; Antisense; GTGGATACTCCTCCGGCGGTGCCTC
>probe:Drosophila_2:1637963_at:305:465; Interrogation_Position=649; Antisense; GTTGGGCCCAGAGCAGTTGGTAAAT
>probe:Drosophila_2:1637963_at:707:587; Interrogation_Position=666; Antisense; TGGTAAATGCTCTCCGTTGGTCAAC
>probe:Drosophila_2:1637963_at:30:3; Interrogation_Position=681; Antisense; GTTGGTCAACGGATACTAACTTGTT
>probe:Drosophila_2:1637963_at:624:189; Interrogation_Position=698; Antisense; AACTTGTTACTGTTTCTCACTGACC
>probe:Drosophila_2:1637963_at:70:479; Interrogation_Position=709; Antisense; GTTTCTCACTGACCTTAATTGTAAA
>probe:Drosophila_2:1637963_at:184:661; Interrogation_Position=730; Antisense; TAAATACTTCCCAACATTAACCAAT
>probe:Drosophila_2:1637963_at:113:87; Interrogation_Position=760; Antisense; AGTGCGGTATAGAAGAGCCATTTCC
>probe:Drosophila_2:1637963_at:691:415; Interrogation_Position=774; Antisense; GAGCCATTTCCACTATCAAAACAGA

Paste this into a BLAST search page for me
GAGGCGGCAGCACGATTAAGATCATGATCATCAAGGTGATCACCGATTCCCCTCCGGTGGTTACAGTGGCGGCCAAGCGGTGGCAACGTCAAGATCATCAATCAAGGTCATCTCCGACGCCGGATGTGGATACTCCTCCGGCGGTGCCTCGTTGGGCCCAGAGCAGTTGGTAAATTGGTAAATGCTCTCCGTTGGTCAACGTTGGTCAACGGATACTAACTTGTTAACTTGTTACTGTTTCTCACTGACCGTTTCTCACTGACCTTAATTGTAAATAAATACTTCCCAACATTAACCAATAGTGCGGTATAGAAGAGCCATTTCCGAGCCATTTCCACTATCAAAACAGA

Full Affymetrix probeset data:

Annotations for 1637963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720