FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637964_at:

>probe:Drosophila_2:1637964_at:362:193; Interrogation_Position=106; Antisense; AACTCAGGAAGCTTCGGGTCGCCAA
>probe:Drosophila_2:1637964_at:131:699; Interrogation_Position=142; Antisense; TTTATTCGCCAACTGTCTTCGTGAA
>probe:Drosophila_2:1637964_at:137:643; Interrogation_Position=157; Antisense; TCTTCGTGAACAGCCAACCGTGGGA
>probe:Drosophila_2:1637964_at:241:91; Interrogation_Position=16; Antisense; AGTAGTTATCAAGTTCACCTCAAAA
>probe:Drosophila_2:1637964_at:45:455; Interrogation_Position=191; Antisense; GATACGGTGGATCTATTCAATTCAT
>probe:Drosophila_2:1637964_at:234:243; Interrogation_Position=246; Antisense; AATTAACCCGTTGTGAGCTGGTCAA
>probe:Drosophila_2:1637964_at:612:333; Interrogation_Position=262; Antisense; GCTGGTCAAAGCCTCGTGCATAGTA
>probe:Drosophila_2:1637964_at:627:541; Interrogation_Position=292; Antisense; GGTTCGCTGCGAAAATGGGTCCTGC
>probe:Drosophila_2:1637964_at:8:185; Interrogation_Position=318; Antisense; AAAATGTTGCCGATAGCCTGCGGTC
>probe:Drosophila_2:1637964_at:284:247; Interrogation_Position=349; Antisense; AATTGCATTGTTTTACTCTTGTGAG
>probe:Drosophila_2:1637964_at:638:149; Interrogation_Position=41; Antisense; ACTTCTGCAATGTCAAAACTTCTGG
>probe:Drosophila_2:1637964_at:326:149; Interrogation_Position=58; Antisense; ACTTCTGGTATTTTTGGCTTTCTGC
>probe:Drosophila_2:1637964_at:464:571; Interrogation_Position=73; Antisense; GGCTTTCTGCTGCATATTGATGTGC
>probe:Drosophila_2:1637964_at:43:607; Interrogation_Position=90; Antisense; TGATGTGCCAGGTCCTAACTCAGGA

Paste this into a BLAST search page for me
AACTCAGGAAGCTTCGGGTCGCCAATTTATTCGCCAACTGTCTTCGTGAATCTTCGTGAACAGCCAACCGTGGGAAGTAGTTATCAAGTTCACCTCAAAAGATACGGTGGATCTATTCAATTCATAATTAACCCGTTGTGAGCTGGTCAAGCTGGTCAAAGCCTCGTGCATAGTAGGTTCGCTGCGAAAATGGGTCCTGCAAAATGTTGCCGATAGCCTGCGGTCAATTGCATTGTTTTACTCTTGTGAGACTTCTGCAATGTCAAAACTTCTGGACTTCTGGTATTTTTGGCTTTCTGCGGCTTTCTGCTGCATATTGATGTGCTGATGTGCCAGGTCCTAACTCAGGA

Full Affymetrix probeset data:

Annotations for 1637964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720