Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637966_at:

>probe:Drosophila_2:1637966_at:618:89; Interrogation_Position=4547; Antisense; AGTTAATCCCTAATTAGTCCAGTGA
>probe:Drosophila_2:1637966_at:677:677; Interrogation_Position=4561; Antisense; TAGTCCAGTGATTTGTTTTGTTTTT
>probe:Drosophila_2:1637966_at:257:543; Interrogation_Position=4662; Antisense; GGATAGATAGACTAACGCCGCTTGT
>probe:Drosophila_2:1637966_at:483:659; Interrogation_Position=4674; Antisense; TAACGCCGCTTGTACGTAGACAAAC
>probe:Drosophila_2:1637966_at:10:181; Interrogation_Position=4712; Antisense; AAAAACGTGTGCATGGGCCAATGGC
>probe:Drosophila_2:1637966_at:637:685; Interrogation_Position=4801; Antisense; TATACCGATGCGTAAGTGCGTCCTT
>probe:Drosophila_2:1637966_at:310:623; Interrogation_Position=4817; Antisense; TGCGTCCTTACACATTACACATTAC
>probe:Drosophila_2:1637966_at:513:665; Interrogation_Position=4832; Antisense; TACACATTACACACATCTTAGTTGA
>probe:Drosophila_2:1637966_at:280:687; Interrogation_Position=4944; Antisense; TTTCCAAAATTTCCATCGCTTGCGG
>probe:Drosophila_2:1637966_at:604:297; Interrogation_Position=4960; Antisense; CGCTTGCGGCATTTCGTTTGGCTTA
>probe:Drosophila_2:1637966_at:565:275; Interrogation_Position=4991; Antisense; CTTAACGAAAAGTTGCGGTGCACAT
>probe:Drosophila_2:1637966_at:522:715; Interrogation_Position=5032; Antisense; TTCGACTTTTTTGGTATTTTGAGCA
>probe:Drosophila_2:1637966_at:596:723; Interrogation_Position=5050; Antisense; TTGAGCACAGTTTTATTTACATACA
>probe:Drosophila_2:1637966_at:704:681; Interrogation_Position=5080; Antisense; TATGCAATCGGGTTTTCCATTTTAT

Paste this into a BLAST search page for me
AGTTAATCCCTAATTAGTCCAGTGATAGTCCAGTGATTTGTTTTGTTTTTGGATAGATAGACTAACGCCGCTTGTTAACGCCGCTTGTACGTAGACAAACAAAAACGTGTGCATGGGCCAATGGCTATACCGATGCGTAAGTGCGTCCTTTGCGTCCTTACACATTACACATTACTACACATTACACACATCTTAGTTGATTTCCAAAATTTCCATCGCTTGCGGCGCTTGCGGCATTTCGTTTGGCTTACTTAACGAAAAGTTGCGGTGCACATTTCGACTTTTTTGGTATTTTGAGCATTGAGCACAGTTTTATTTACATACATATGCAATCGGGTTTTCCATTTTAT

Full Affymetrix probeset data:

Annotations for 1637966_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime