Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637967_at:

>probe:Drosophila_2:1637967_at:24:619; Interrogation_Position=128; Antisense; TGCAGGAGTTCCTCTTGATTGAGAA
>probe:Drosophila_2:1637967_at:262:371; Interrogation_Position=156; Antisense; GAAGGCACAGGTCAACGCGCAGATA
>probe:Drosophila_2:1637967_at:366:359; Interrogation_Position=218; Antisense; GCAAGCCGAGTACCAAGCTGGACCA
>probe:Drosophila_2:1637967_at:450:461; Interrogation_Position=278; Antisense; GATTCATCGACACGTCGCTGCTTAT
>probe:Drosophila_2:1637967_at:147:331; Interrogation_Position=309; Antisense; GCGGTTCGCTCAGATGCTCCAAAAG
>probe:Drosophila_2:1637967_at:279:513; Interrogation_Position=338; Antisense; GTGGCGGCGACCTGTAGATTTGTTC
>probe:Drosophila_2:1637967_at:633:459; Interrogation_Position=354; Antisense; GATTTGTTCGCTTAATCGACACCGA
>probe:Drosophila_2:1637967_at:217:41; Interrogation_Position=386; Antisense; ATCTGGGTATCCGAGTCCGTGGACG
>probe:Drosophila_2:1637967_at:183:719; Interrogation_Position=412; Antisense; TTCCGTCACTGTCCTACTGTTAAAT
>probe:Drosophila_2:1637967_at:249:47; Interrogation_Position=501; Antisense; ATCCAAAGTATGTGGCCCGTAGTCT
>probe:Drosophila_2:1637967_at:58:17; Interrogation_Position=573; Antisense; ATTTAATTCGGTAGCGCAACTCAAT
>probe:Drosophila_2:1637967_at:532:253; Interrogation_Position=589; Antisense; CAACTCAATTGTTTGGTCGGCCCTA
>probe:Drosophila_2:1637967_at:368:155; Interrogation_Position=83; Antisense; ACACGATGTCCGATTTTGAGAACCT
>probe:Drosophila_2:1637967_at:721:723; Interrogation_Position=98; Antisense; TTGAGAACCTTTCCGGCAATGACAA

Paste this into a BLAST search page for me
TGCAGGAGTTCCTCTTGATTGAGAAGAAGGCACAGGTCAACGCGCAGATAGCAAGCCGAGTACCAAGCTGGACCAGATTCATCGACACGTCGCTGCTTATGCGGTTCGCTCAGATGCTCCAAAAGGTGGCGGCGACCTGTAGATTTGTTCGATTTGTTCGCTTAATCGACACCGAATCTGGGTATCCGAGTCCGTGGACGTTCCGTCACTGTCCTACTGTTAAATATCCAAAGTATGTGGCCCGTAGTCTATTTAATTCGGTAGCGCAACTCAATCAACTCAATTGTTTGGTCGGCCCTAACACGATGTCCGATTTTGAGAACCTTTGAGAACCTTTCCGGCAATGACAA

Full Affymetrix probeset data:

Annotations for 1637967_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime