FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637969_at:

>probe:Drosophila_2:1637969_at:132:611; Interrogation_Position=1015; Antisense; TGACCATGTGTGTCGGCATCTGGAA
>probe:Drosophila_2:1637969_at:458:605; Interrogation_Position=1046; Antisense; TGAGGTGTCTCCATGGATTCACTTG
>probe:Drosophila_2:1637969_at:253:463; Interrogation_Position=1061; Antisense; GATTCACTTGCTTTGCTCTTAGAGG
>probe:Drosophila_2:1637969_at:469:437; Interrogation_Position=1082; Antisense; GAGGCGGACACACAAAACACTTCGT
>probe:Drosophila_2:1637969_at:266:495; Interrogation_Position=563; Antisense; GTCACGATCTACTCAATTCCGGATT
>probe:Drosophila_2:1637969_at:141:719; Interrogation_Position=579; Antisense; TTCCGGATTGGTACCGCAGTTTATC
>probe:Drosophila_2:1637969_at:379:361; Interrogation_Position=620; Antisense; GCAAGGTGCCTGTTTACCTCAAGAA
>probe:Drosophila_2:1637969_at:627:283; Interrogation_Position=709; Antisense; CTGTGCCGCGGTATCAAGGGTTTCA
>probe:Drosophila_2:1637969_at:673:81; Interrogation_Position=736; Antisense; AGGGCATCCGTCCAATCAAGTGGTC
>probe:Drosophila_2:1637969_at:216:407; Interrogation_Position=827; Antisense; GACTGAGCCTGACCGAGATGACCAA
>probe:Drosophila_2:1637969_at:433:91; Interrogation_Position=854; Antisense; AGTATCAGTCGATGTCGCTCCTTAT
>probe:Drosophila_2:1637969_at:663:209; Interrogation_Position=906; Antisense; AAGCAAGCTGGAGTCCGATCTTCGC
>probe:Drosophila_2:1637969_at:672:401; Interrogation_Position=943; Antisense; GACATTCTGCTAATCGAGACCACTC
>probe:Drosophila_2:1637969_at:35:425; Interrogation_Position=958; Antisense; GAGACCACTCCCATTATCTATGTTT

Paste this into a BLAST search page for me
TGACCATGTGTGTCGGCATCTGGAATGAGGTGTCTCCATGGATTCACTTGGATTCACTTGCTTTGCTCTTAGAGGGAGGCGGACACACAAAACACTTCGTGTCACGATCTACTCAATTCCGGATTTTCCGGATTGGTACCGCAGTTTATCGCAAGGTGCCTGTTTACCTCAAGAACTGTGCCGCGGTATCAAGGGTTTCAAGGGCATCCGTCCAATCAAGTGGTCGACTGAGCCTGACCGAGATGACCAAAGTATCAGTCGATGTCGCTCCTTATAAGCAAGCTGGAGTCCGATCTTCGCGACATTCTGCTAATCGAGACCACTCGAGACCACTCCCATTATCTATGTTT

Full Affymetrix probeset data:

Annotations for 1637969_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720