FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637972_at:

>probe:Drosophila_2:1637972_at:433:679; Interrogation_Position=101; Antisense; TAGGAGCCTGCAACTGGTCCGGTAA
>probe:Drosophila_2:1637972_at:571:503; Interrogation_Position=117; Antisense; GTCCGGTAAGCTGACCTTTTTGATG
>probe:Drosophila_2:1637972_at:143:333; Interrogation_Position=126; Antisense; GCTGACCTTTTTGATGCAGTGGAAG
>probe:Drosophila_2:1637972_at:328:591; Interrogation_Position=170; Antisense; TGGTGCCCGCCGAAGTGCTCAACGT
>probe:Drosophila_2:1637972_at:315:119; Interrogation_Position=19; Antisense; AGCTCCACTTTGACGTCCTCTACTG
>probe:Drosophila_2:1637972_at:498:295; Interrogation_Position=203; Antisense; CCCAAATGGTCATCTCGTTCTACGA
>probe:Drosophila_2:1637972_at:304:295; Interrogation_Position=225; Antisense; CGAGGAGCGTATTGTGTTCACGGAT
>probe:Drosophila_2:1637972_at:310:65; Interrogation_Position=281; Antisense; ATGGGTATGAGACCACTCCGAGTCC
>probe:Drosophila_2:1637972_at:280:415; Interrogation_Position=291; Antisense; GACCACTCCGAGTCCCAGGAAGAAA
>probe:Drosophila_2:1637972_at:384:375; Interrogation_Position=309; Antisense; GAAGAAACGATCACGAAATGCCTAG
>probe:Drosophila_2:1637972_at:617:143; Interrogation_Position=40; Antisense; ACTGCTCTTCCGGTGAAGCAACGAA
>probe:Drosophila_2:1637972_at:159:65; Interrogation_Position=65; Antisense; ATGGATTTGATCTTGGACTCGAACC
>probe:Drosophila_2:1637972_at:133:453; Interrogation_Position=73; Antisense; GATCTTGGACTCGAACCGTTGCGGA
>probe:Drosophila_2:1637972_at:85:379; Interrogation_Position=85; Antisense; GAACCGTTGCGGATCTTAGGAGCCT

Paste this into a BLAST search page for me
TAGGAGCCTGCAACTGGTCCGGTAAGTCCGGTAAGCTGACCTTTTTGATGGCTGACCTTTTTGATGCAGTGGAAGTGGTGCCCGCCGAAGTGCTCAACGTAGCTCCACTTTGACGTCCTCTACTGCCCAAATGGTCATCTCGTTCTACGACGAGGAGCGTATTGTGTTCACGGATATGGGTATGAGACCACTCCGAGTCCGACCACTCCGAGTCCCAGGAAGAAAGAAGAAACGATCACGAAATGCCTAGACTGCTCTTCCGGTGAAGCAACGAAATGGATTTGATCTTGGACTCGAACCGATCTTGGACTCGAACCGTTGCGGAGAACCGTTGCGGATCTTAGGAGCCT

Full Affymetrix probeset data:

Annotations for 1637972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720