Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637975_at:

>probe:Drosophila_2:1637975_at:619:319; Interrogation_Position=11519; Antisense; GCCGCCTTGAGTTTTTGCAGCACTG
>probe:Drosophila_2:1637975_at:175:143; Interrogation_Position=11540; Antisense; ACTGGTTTGATCATGGAGCTCCTTC
>probe:Drosophila_2:1637975_at:703:679; Interrogation_Position=11590; Antisense; TTCACTCAGGCCTTTTTAACCGGTG
>probe:Drosophila_2:1637975_at:544:535; Interrogation_Position=11611; Antisense; GGTGCCCAGCAGAACTATGCGCGAA
>probe:Drosophila_2:1637975_at:87:453; Interrogation_Position=11653; Antisense; GATCTTCTGGCCTTCGATTACGAAG
>probe:Drosophila_2:1637975_at:484:301; Interrogation_Position=11719; Antisense; CCCGAGGATGGCGTCTTTGTGTATG
>probe:Drosophila_2:1637975_at:611:417; Interrogation_Position=11869; Antisense; GAGCGTCATAACTATCTGTGTCCCA
>probe:Drosophila_2:1637975_at:236:517; Interrogation_Position=11886; Antisense; GTGTCCCATGTACAAGACTGCCGAA
>probe:Drosophila_2:1637975_at:451:437; Interrogation_Position=11915; Antisense; GAGGAGTATTGTCCACCACTGGTCA
>probe:Drosophila_2:1637975_at:294:519; Interrogation_Position=11953; Antisense; GTGGTGGCCATGTTGCTACTCTGCA
>probe:Drosophila_2:1637975_at:288:235; Interrogation_Position=11977; Antisense; AATCCGAATACTCCAGTCTCACATT
>probe:Drosophila_2:1637975_at:381:257; Interrogation_Position=11996; Antisense; CACATTGGATTATTCGCGGCACGGC
>probe:Drosophila_2:1637975_at:416:257; Interrogation_Position=12015; Antisense; CACGGCTTTGTTGTGCCAGCTGAGT
>probe:Drosophila_2:1637975_at:605:709; Interrogation_Position=12084; Antisense; TTAAGGTCTGCTTGAGGCTCATTAA

Paste this into a BLAST search page for me
GCCGCCTTGAGTTTTTGCAGCACTGACTGGTTTGATCATGGAGCTCCTTCTTCACTCAGGCCTTTTTAACCGGTGGGTGCCCAGCAGAACTATGCGCGAAGATCTTCTGGCCTTCGATTACGAAGCCCGAGGATGGCGTCTTTGTGTATGGAGCGTCATAACTATCTGTGTCCCAGTGTCCCATGTACAAGACTGCCGAAGAGGAGTATTGTCCACCACTGGTCAGTGGTGGCCATGTTGCTACTCTGCAAATCCGAATACTCCAGTCTCACATTCACATTGGATTATTCGCGGCACGGCCACGGCTTTGTTGTGCCAGCTGAGTTTAAGGTCTGCTTGAGGCTCATTAA

Full Affymetrix probeset data:

Annotations for 1637975_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime