FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637978_at:

>probe:Drosophila_2:1637978_at:404:591; Interrogation_Position=1044; Antisense; TGGTCAGGTTCATCCATTGGATCCA
>probe:Drosophila_2:1637978_at:117:541; Interrogation_Position=1091; Antisense; GGTTTCCTCTATGTCAGGTGCATTT
>probe:Drosophila_2:1637978_at:648:713; Interrogation_Position=607; Antisense; TTCTTTATGACTGCCCTGGAACAGG
>probe:Drosophila_2:1637978_at:81:537; Interrogation_Position=660; Antisense; GGTCAAGGATTCTGCGTGGCGTTCC
>probe:Drosophila_2:1637978_at:393:3; Interrogation_Position=687; Antisense; ATTGGACTACCTTCAAGCGAGCCTA
>probe:Drosophila_2:1637978_at:59:247; Interrogation_Position=740; Antisense; AATTCTATGAACTTTCGCGCTGCCT
>probe:Drosophila_2:1637978_at:473:191; Interrogation_Position=766; Antisense; AACTTCTCCTCTTTAGATAACCTGC
>probe:Drosophila_2:1637978_at:280:455; Interrogation_Position=781; Antisense; GATAACCTGCGTCAGTTTGCAGCAG
>probe:Drosophila_2:1637978_at:730:535; Interrogation_Position=813; Antisense; GGTCAAAGGCATTCAGCTGATTCAT
>probe:Drosophila_2:1637978_at:643:119; Interrogation_Position=827; Antisense; AGCTGATTCATCCTGTAGTGCACAA
>probe:Drosophila_2:1637978_at:466:543; Interrogation_Position=862; Antisense; GGATTAGTGCATCTCTTGCCAGGAG
>probe:Drosophila_2:1637978_at:118:75; Interrogation_Position=882; Antisense; AGGAGATGATGCTTACCCCGCCGAT
>probe:Drosophila_2:1637978_at:148:303; Interrogation_Position=899; Antisense; CCGCCGATCCGGATGCAAGTAACGA
>probe:Drosophila_2:1637978_at:451:43; Interrogation_Position=983; Antisense; ATCGATCGGAGCACTGGAACCAGCA

Paste this into a BLAST search page for me
TGGTCAGGTTCATCCATTGGATCCAGGTTTCCTCTATGTCAGGTGCATTTTTCTTTATGACTGCCCTGGAACAGGGGTCAAGGATTCTGCGTGGCGTTCCATTGGACTACCTTCAAGCGAGCCTAAATTCTATGAACTTTCGCGCTGCCTAACTTCTCCTCTTTAGATAACCTGCGATAACCTGCGTCAGTTTGCAGCAGGGTCAAAGGCATTCAGCTGATTCATAGCTGATTCATCCTGTAGTGCACAAGGATTAGTGCATCTCTTGCCAGGAGAGGAGATGATGCTTACCCCGCCGATCCGCCGATCCGGATGCAAGTAACGAATCGATCGGAGCACTGGAACCAGCA

Full Affymetrix probeset data:

Annotations for 1637978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720