FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637979_at:

>probe:Drosophila_2:1637979_at:382:729; Interrogation_Position=589; Antisense; TTGTGAACGTTAGGGTATGCGCTAC
>probe:Drosophila_2:1637979_at:380:611; Interrogation_Position=592; Antisense; TGAACGTTAGGGTATGCGCTACTAC
>probe:Drosophila_2:1637979_at:201:139; Interrogation_Position=595; Antisense; ACGTTAGGGTATGCGCTACTACCAT
>probe:Drosophila_2:1637979_at:512:677; Interrogation_Position=599; Antisense; TAGGGTATGCGCTACTACCATTTCC
>probe:Drosophila_2:1637979_at:163:485; Interrogation_Position=603; Antisense; GTATGCGCTACTACCATTTCCTCGA
>probe:Drosophila_2:1637979_at:218:669; Interrogation_Position=611; Antisense; TACTACCATTTCCTCGACTGTGCTT
>probe:Drosophila_2:1637979_at:523:673; Interrogation_Position=614; Antisense; TACCATTTCCTCGACTGTGCTTAGT
>probe:Drosophila_2:1637979_at:308:273; Interrogation_Position=617; Antisense; CATTTCCTCGACTGTGCTTAGTGAC
>probe:Drosophila_2:1637979_at:707:717; Interrogation_Position=620; Antisense; TTCCTCGACTGTGCTTAGTGACTAT
>probe:Drosophila_2:1637979_at:284:281; Interrogation_Position=623; Antisense; CTCGACTGTGCTTAGTGACTATTCT
>probe:Drosophila_2:1637979_at:154:405; Interrogation_Position=626; Antisense; GACTGTGCTTAGTGACTATTCTATT
>probe:Drosophila_2:1637979_at:331:343; Interrogation_Position=632; Antisense; GCTTAGTGACTATTCTATTGTTATT
>probe:Drosophila_2:1637979_at:459:711; Interrogation_Position=644; Antisense; TTCTATTGTTATTTTCCAGGAACTA
>probe:Drosophila_2:1637979_at:192:477; Interrogation_Position=651; Antisense; GTTATTTTCCAGGAACTATTCATTG

Paste this into a BLAST search page for me
TTGTGAACGTTAGGGTATGCGCTACTGAACGTTAGGGTATGCGCTACTACACGTTAGGGTATGCGCTACTACCATTAGGGTATGCGCTACTACCATTTCCGTATGCGCTACTACCATTTCCTCGATACTACCATTTCCTCGACTGTGCTTTACCATTTCCTCGACTGTGCTTAGTCATTTCCTCGACTGTGCTTAGTGACTTCCTCGACTGTGCTTAGTGACTATCTCGACTGTGCTTAGTGACTATTCTGACTGTGCTTAGTGACTATTCTATTGCTTAGTGACTATTCTATTGTTATTTTCTATTGTTATTTTCCAGGAACTAGTTATTTTCCAGGAACTATTCATTG

Full Affymetrix probeset data:

Annotations for 1637979_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720