FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637980_at:

>probe:Drosophila_2:1637980_at:136:339; Interrogation_Position=105; Antisense; GCTCGGCACAATTTTGGCATTCTTT
>probe:Drosophila_2:1637980_at:442:343; Interrogation_Position=121; Antisense; GCATTCTTTTCTGTAATCTCGGCGA
>probe:Drosophila_2:1637980_at:322:235; Interrogation_Position=135; Antisense; AATCTCGGCGACAATGGCGGCTAAC
>probe:Drosophila_2:1637980_at:721:71; Interrogation_Position=166; Antisense; AGGACTTTCATCATGGTCAAGCCCG
>probe:Drosophila_2:1637980_at:313:123; Interrogation_Position=200; Antisense; AGCGCGGGCTCGTCGGCAAGATCAT
>probe:Drosophila_2:1637980_at:557:453; Interrogation_Position=219; Antisense; GATCATCGAGCGCTTCGAGCAGAAG
>probe:Drosophila_2:1637980_at:444:613; Interrogation_Position=263; Antisense; TGAAGTTCACCTGGGCCTCCAAGGA
>probe:Drosophila_2:1637980_at:566:549; Interrogation_Position=294; Antisense; GGAGAAGCACTACGCTGATCTGTCC
>probe:Drosophila_2:1637980_at:378:405; Interrogation_Position=338; Antisense; GACTCGTGAACTACATGAACTCCGG
>probe:Drosophila_2:1637980_at:532:63; Interrogation_Position=395; Antisense; ATGTGGTCAAGACCGGTCGCCAGAT
>probe:Drosophila_2:1637980_at:418:149; Interrogation_Position=470; Antisense; ACTTCTGCATTCAGGTCGGACGCAA
>probe:Drosophila_2:1637980_at:308:427; Interrogation_Position=535; Antisense; GAGATCGCCCTGTGGTTCAACGAAA
>probe:Drosophila_2:1637980_at:699:103; Interrogation_Position=608; Antisense; AGACGGCTACTTTAACTGTCTGCCC
>probe:Drosophila_2:1637980_at:543:625; Interrogation_Position=628; Antisense; TGCCCTCGTCTAAGCTGAATACAGA

Paste this into a BLAST search page for me
GCTCGGCACAATTTTGGCATTCTTTGCATTCTTTTCTGTAATCTCGGCGAAATCTCGGCGACAATGGCGGCTAACAGGACTTTCATCATGGTCAAGCCCGAGCGCGGGCTCGTCGGCAAGATCATGATCATCGAGCGCTTCGAGCAGAAGTGAAGTTCACCTGGGCCTCCAAGGAGGAGAAGCACTACGCTGATCTGTCCGACTCGTGAACTACATGAACTCCGGATGTGGTCAAGACCGGTCGCCAGATACTTCTGCATTCAGGTCGGACGCAAGAGATCGCCCTGTGGTTCAACGAAAAGACGGCTACTTTAACTGTCTGCCCTGCCCTCGTCTAAGCTGAATACAGA

Full Affymetrix probeset data:

Annotations for 1637980_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720