Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637982_at:

>probe:Drosophila_2:1637982_at:35:501; Interrogation_Position=1014; Antisense; GTCTGATACAGTCGACACTTGGCAT
>probe:Drosophila_2:1637982_at:204:399; Interrogation_Position=1027; Antisense; GACACTTGGCATTTCATTCATCTCA
>probe:Drosophila_2:1637982_at:520:607; Interrogation_Position=1054; Antisense; TGAGATGTTCTCCTGGGCTGATTCC
>probe:Drosophila_2:1637982_at:72:525; Interrogation_Position=1068; Antisense; GGGCTGATTCCATCACAAGATCCAT
>probe:Drosophila_2:1637982_at:98:449; Interrogation_Position=1086; Antisense; GATCCATGATCTATCTGTAGTCCAA
>probe:Drosophila_2:1637982_at:703:565; Interrogation_Position=613; Antisense; GGCACCATTGCCTTGATTGACGAGG
>probe:Drosophila_2:1637982_at:16:447; Interrogation_Position=676; Antisense; GATCCGTTGGCCTCGAAAGTCAATG
>probe:Drosophila_2:1637982_at:501:439; Interrogation_Position=709; Antisense; GATGTGGACCAGTACTTCCCGGGTC
>probe:Drosophila_2:1637982_at:678:715; Interrogation_Position=737; Antisense; TTCGTGCCACCGTTGAGTGGTTCAA
>probe:Drosophila_2:1637982_at:317:453; Interrogation_Position=762; Antisense; GATCTACAAGATCCCCGATGGCAAG
>probe:Drosophila_2:1637982_at:551:365; Interrogation_Position=792; Antisense; GAATCAGTTTGCTTTCAACGGCGAT
>probe:Drosophila_2:1637982_at:50:253; Interrogation_Position=819; Antisense; CAAGAATGCGGACTTTGCCAACACC
>probe:Drosophila_2:1637982_at:637:317; Interrogation_Position=850; Antisense; GCCGAGACCCACAAGTTCTGGCAGA
>probe:Drosophila_2:1637982_at:326:553; Interrogation_Position=939; Antisense; GGAGCACGTCATTCCCAAGGAGGAG

Paste this into a BLAST search page for me
GTCTGATACAGTCGACACTTGGCATGACACTTGGCATTTCATTCATCTCATGAGATGTTCTCCTGGGCTGATTCCGGGCTGATTCCATCACAAGATCCATGATCCATGATCTATCTGTAGTCCAAGGCACCATTGCCTTGATTGACGAGGGATCCGTTGGCCTCGAAAGTCAATGGATGTGGACCAGTACTTCCCGGGTCTTCGTGCCACCGTTGAGTGGTTCAAGATCTACAAGATCCCCGATGGCAAGGAATCAGTTTGCTTTCAACGGCGATCAAGAATGCGGACTTTGCCAACACCGCCGAGACCCACAAGTTCTGGCAGAGGAGCACGTCATTCCCAAGGAGGAG

Full Affymetrix probeset data:

Annotations for 1637982_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime