FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637985_at:

>probe:Drosophila_2:1637985_at:432:727; Interrogation_Position=1033; Antisense; TTGGGACCTCCAATGCAGCGCATGA
>probe:Drosophila_2:1637985_at:349:85; Interrogation_Position=1101; Antisense; AGTAAATTCCAATTCCCTGGCCTAT
>probe:Drosophila_2:1637985_at:724:203; Interrogation_Position=1128; Antisense; AAGCCATCTGGTTCGTGCTTTCGAG
>probe:Drosophila_2:1637985_at:157:419; Interrogation_Position=1150; Antisense; GAGCTGTGTGCCTTCATCATGGTCA
>probe:Drosophila_2:1637985_at:55:647; Interrogation_Position=1166; Antisense; TCATGGTCACCTGTTTCGTAGTATC
>probe:Drosophila_2:1637985_at:252:637; Interrogation_Position=1181; Antisense; TCGTAGTATCTTCGCTGAACTGCCT
>probe:Drosophila_2:1637985_at:583:357; Interrogation_Position=1209; Antisense; GCAAATCCATTGCAAGCGCCAGCAG
>probe:Drosophila_2:1637985_at:444:455; Interrogation_Position=1279; Antisense; GATACGGAGACATCCTCGTCGGAGG
>probe:Drosophila_2:1637985_at:323:437; Interrogation_Position=1300; Antisense; GAGGAGTTCAGCGTCTAAGCAGCAT
>probe:Drosophila_2:1637985_at:75:515; Interrogation_Position=1387; Antisense; GTGTCTTGTAATGTCCTATATCCTT
>probe:Drosophila_2:1637985_at:58:559; Interrogation_Position=901; Antisense; TGGAAGTTCTTTGTGGCCACCCTGA
>probe:Drosophila_2:1637985_at:351:227; Interrogation_Position=943; Antisense; AAGGCCACCATACAGCAGTTGTTTG
>probe:Drosophila_2:1637985_at:541:261; Interrogation_Position=958; Antisense; CAGTTGTTTGTTATTGCGTCCCTAA
>probe:Drosophila_2:1637985_at:91:715; Interrogation_Position=971; Antisense; TTGCGTCCCTAACCGAGAGTCTAGT

Paste this into a BLAST search page for me
TTGGGACCTCCAATGCAGCGCATGAAGTAAATTCCAATTCCCTGGCCTATAAGCCATCTGGTTCGTGCTTTCGAGGAGCTGTGTGCCTTCATCATGGTCATCATGGTCACCTGTTTCGTAGTATCTCGTAGTATCTTCGCTGAACTGCCTGCAAATCCATTGCAAGCGCCAGCAGGATACGGAGACATCCTCGTCGGAGGGAGGAGTTCAGCGTCTAAGCAGCATGTGTCTTGTAATGTCCTATATCCTTTGGAAGTTCTTTGTGGCCACCCTGAAAGGCCACCATACAGCAGTTGTTTGCAGTTGTTTGTTATTGCGTCCCTAATTGCGTCCCTAACCGAGAGTCTAGT

Full Affymetrix probeset data:

Annotations for 1637985_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720