FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637986_at:

>probe:Drosophila_2:1637986_at:599:99; Interrogation_Position=178; Antisense; AGATGGCCCAATCGCATTATTTATT
>probe:Drosophila_2:1637986_at:149:43; Interrogation_Position=233; Antisense; ATCGTAACCACATCGTGAGCGCTAT
>probe:Drosophila_2:1637986_at:348:237; Interrogation_Position=264; Antisense; AATCGAATCCATTTCATGCCTGACC
>probe:Drosophila_2:1637986_at:257:609; Interrogation_Position=284; Antisense; TGACCTTCAAAGAGGCCACCACTGA
>probe:Drosophila_2:1637986_at:277:703; Interrogation_Position=318; Antisense; TTATGTAAATGTGACCTCCGAGGAG
>probe:Drosophila_2:1637986_at:517:477; Interrogation_Position=350; Antisense; GTTTCTCCTACATCGGTTATCTGAA
>probe:Drosophila_2:1637986_at:360:611; Interrogation_Position=405; Antisense; TGAAATAGGCGTCGGTTGTTTCCGT
>probe:Drosophila_2:1637986_at:352:619; Interrogation_Position=455; Antisense; TGCATGCCCTTGGATTTTTCCATCA
>probe:Drosophila_2:1637986_at:526:459; Interrogation_Position=467; Antisense; GATTTTTCCATCAGCAAAGTGCCGC
>probe:Drosophila_2:1637986_at:137:221; Interrogation_Position=483; Antisense; AAGTGCCGCCGATCGGGATGATTAT
>probe:Drosophila_2:1637986_at:660:351; Interrogation_Position=608; Antisense; GCAGCGTAATGCACTATGGTCCCTA
>probe:Drosophila_2:1637986_at:182:679; Interrogation_Position=622; Antisense; TATGGTCCCTATGCATTTTCCAAGA
>probe:Drosophila_2:1637986_at:28:339; Interrogation_Position=735; Antisense; GCTAAATGCCATCTACAAATGCCCC
>probe:Drosophila_2:1637986_at:547:157; Interrogation_Position=749; Antisense; ACAAATGCCCCACCGTCAAAGAATG

Paste this into a BLAST search page for me
AGATGGCCCAATCGCATTATTTATTATCGTAACCACATCGTGAGCGCTATAATCGAATCCATTTCATGCCTGACCTGACCTTCAAAGAGGCCACCACTGATTATGTAAATGTGACCTCCGAGGAGGTTTCTCCTACATCGGTTATCTGAATGAAATAGGCGTCGGTTGTTTCCGTTGCATGCCCTTGGATTTTTCCATCAGATTTTTCCATCAGCAAAGTGCCGCAAGTGCCGCCGATCGGGATGATTATGCAGCGTAATGCACTATGGTCCCTATATGGTCCCTATGCATTTTCCAAGAGCTAAATGCCATCTACAAATGCCCCACAAATGCCCCACCGTCAAAGAATG

Full Affymetrix probeset data:

Annotations for 1637986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720