FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637987_at:

>probe:Drosophila_2:1637987_at:23:651; Interrogation_Position=6098; Antisense; TCAGCGTTCTGTACGAGAGCGAGGT
>probe:Drosophila_2:1637987_at:403:513; Interrogation_Position=6121; Antisense; GTGATACCCAAGGAGTCGTTCGACA
>probe:Drosophila_2:1637987_at:165:441; Interrogation_Position=6162; Antisense; GATGGCACATTCGAGAGCCTACCGT
>probe:Drosophila_2:1637987_at:552:289; Interrogation_Position=6184; Antisense; CGTCGCCCATTCATTGACAAACTGC
>probe:Drosophila_2:1637987_at:13:661; Interrogation_Position=6244; Antisense; TAACCAGCCCATCGGATTGCAGAGA
>probe:Drosophila_2:1637987_at:219:203; Interrogation_Position=6294; Antisense; AACCAACCACAAACTGATCCATACG
>probe:Drosophila_2:1637987_at:125:671; Interrogation_Position=6315; Antisense; TACGGCAACATCGTTTGAAACCATT
>probe:Drosophila_2:1637987_at:558:7; Interrogation_Position=6337; Antisense; ATTCCTTAGACTAGGCGCGGTCGTA
>probe:Drosophila_2:1637987_at:491:297; Interrogation_Position=6352; Antisense; CGCGGTCGTAGGTGTCGAAGTCAAA
>probe:Drosophila_2:1637987_at:226:533; Interrogation_Position=6431; Antisense; GGGTGTCTCTCTAACACATTTGTTT
>probe:Drosophila_2:1637987_at:137:481; Interrogation_Position=6505; Antisense; GTTTGCACGATGACTAGATCAGACG
>probe:Drosophila_2:1637987_at:460:663; Interrogation_Position=6552; Antisense; TACACAGATTTCTTTGGGAACCTAA
>probe:Drosophila_2:1637987_at:155:21; Interrogation_Position=6591; Antisense; ATTTGTATCACAACACGTTCCTTAA
>probe:Drosophila_2:1637987_at:253:689; Interrogation_Position=6630; Antisense; TATTCCCTTTGTATGACTTGGTCAT

Paste this into a BLAST search page for me
TCAGCGTTCTGTACGAGAGCGAGGTGTGATACCCAAGGAGTCGTTCGACAGATGGCACATTCGAGAGCCTACCGTCGTCGCCCATTCATTGACAAACTGCTAACCAGCCCATCGGATTGCAGAGAAACCAACCACAAACTGATCCATACGTACGGCAACATCGTTTGAAACCATTATTCCTTAGACTAGGCGCGGTCGTACGCGGTCGTAGGTGTCGAAGTCAAAGGGTGTCTCTCTAACACATTTGTTTGTTTGCACGATGACTAGATCAGACGTACACAGATTTCTTTGGGAACCTAAATTTGTATCACAACACGTTCCTTAATATTCCCTTTGTATGACTTGGTCAT

Full Affymetrix probeset data:

Annotations for 1637987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720