Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637988_at:

>probe:Drosophila_2:1637988_at:26:375; Interrogation_Position=123; Antisense; GAAGAAGCGGGAACTTTATCCGCCG
>probe:Drosophila_2:1637988_at:14:705; Interrogation_Position=138; Antisense; TTATCCGCCGGAAAGCAAAAGCCAC
>probe:Drosophila_2:1637988_at:531:255; Interrogation_Position=153; Antisense; CAAAAGCCACCACGAGGAGCTGCAG
>probe:Drosophila_2:1637988_at:314:617; Interrogation_Position=173; Antisense; TGCAGCGGGCAATCCGTGAACACCA
>probe:Drosophila_2:1637988_at:379:309; Interrogation_Position=201; Antisense; CCAGCACGACGCCAAAATGATGCGT
>probe:Drosophila_2:1637988_at:691:299; Interrogation_Position=210; Antisense; CGCCAAAATGATGCGTGCTATGGAG
>probe:Drosophila_2:1637988_at:438:99; Interrogation_Position=41; Antisense; AGATGGGCATGTACATGGCCTTTCC
>probe:Drosophila_2:1637988_at:342:269; Interrogation_Position=48; Antisense; CATGTACATGGCCTTTCCGGTGACG
>probe:Drosophila_2:1637988_at:76:667; Interrogation_Position=52; Antisense; TACATGGCCTTTCCGGTGACGCTAT
>probe:Drosophila_2:1637988_at:503:289; Interrogation_Position=65; Antisense; CGGTGACGCTATTCCACTTGTTTAA
>probe:Drosophila_2:1637988_at:402:411; Interrogation_Position=69; Antisense; GACGCTATTCCACTTGTTTAACCAG
>probe:Drosophila_2:1637988_at:20:691; Interrogation_Position=74; Antisense; TATTCCACTTGTTTAACCAGCCGGA
>probe:Drosophila_2:1637988_at:697:657; Interrogation_Position=87; Antisense; TAACCAGCCGGAATACTTTGAAGAA
>probe:Drosophila_2:1637988_at:442:29; Interrogation_Position=99; Antisense; ATACTTTGAAGAATGGGTGACCAAG

Paste this into a BLAST search page for me
GAAGAAGCGGGAACTTTATCCGCCGTTATCCGCCGGAAAGCAAAAGCCACCAAAAGCCACCACGAGGAGCTGCAGTGCAGCGGGCAATCCGTGAACACCACCAGCACGACGCCAAAATGATGCGTCGCCAAAATGATGCGTGCTATGGAGAGATGGGCATGTACATGGCCTTTCCCATGTACATGGCCTTTCCGGTGACGTACATGGCCTTTCCGGTGACGCTATCGGTGACGCTATTCCACTTGTTTAAGACGCTATTCCACTTGTTTAACCAGTATTCCACTTGTTTAACCAGCCGGATAACCAGCCGGAATACTTTGAAGAAATACTTTGAAGAATGGGTGACCAAG

Full Affymetrix probeset data:

Annotations for 1637988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime