Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637989_at:

>probe:Drosophila_2:1637989_at:354:77; Interrogation_Position=1687; Antisense; AGGAGTCCAGCGATCCCTTGAGTAA
>probe:Drosophila_2:1637989_at:162:659; Interrogation_Position=1709; Antisense; TAACTCCAACGATAACTAACGCCCT
>probe:Drosophila_2:1637989_at:671:279; Interrogation_Position=1724; Antisense; CTAACGCCCTCACGAATTTATTCAA
>probe:Drosophila_2:1637989_at:323:397; Interrogation_Position=1788; Antisense; GACAAGCCGACACATGCTGACAGAT
>probe:Drosophila_2:1637989_at:434:383; Interrogation_Position=1867; Antisense; GAACGGAGCCATCACTTGACATGTC
>probe:Drosophila_2:1637989_at:611:267; Interrogation_Position=1886; Antisense; CATGTCAGTGAACAACGGACCGGGT
>probe:Drosophila_2:1637989_at:185:413; Interrogation_Position=1911; Antisense; GACCGGGTGCAGTCACAGTTATTTT
>probe:Drosophila_2:1637989_at:30:609; Interrogation_Position=1935; Antisense; TGAGGATAACATGGCCACATCAATC
>probe:Drosophila_2:1637989_at:203:151; Interrogation_Position=1951; Antisense; ACATCAATCACTGCGGTTCCAAGAA
>probe:Drosophila_2:1637989_at:613:297; Interrogation_Position=2026; Antisense; CGCCATTACCGACTGACAATCACAA
>probe:Drosophila_2:1637989_at:139:693; Interrogation_Position=2096; Antisense; TTTGGGTGACAAACCTCAGGATCAA
>probe:Drosophila_2:1637989_at:194:455; Interrogation_Position=2115; Antisense; GATCAATAAATCACCGAACACGGCA
>probe:Drosophila_2:1637989_at:465:163; Interrogation_Position=2151; Antisense; AAATTCTGATGCTGCTGTGGTGCTT
>probe:Drosophila_2:1637989_at:628:591; Interrogation_Position=2168; Antisense; TGGTGCTTGGCGTGCGACAATTTAA

Paste this into a BLAST search page for me
AGGAGTCCAGCGATCCCTTGAGTAATAACTCCAACGATAACTAACGCCCTCTAACGCCCTCACGAATTTATTCAAGACAAGCCGACACATGCTGACAGATGAACGGAGCCATCACTTGACATGTCCATGTCAGTGAACAACGGACCGGGTGACCGGGTGCAGTCACAGTTATTTTTGAGGATAACATGGCCACATCAATCACATCAATCACTGCGGTTCCAAGAACGCCATTACCGACTGACAATCACAATTTGGGTGACAAACCTCAGGATCAAGATCAATAAATCACCGAACACGGCAAAATTCTGATGCTGCTGTGGTGCTTTGGTGCTTGGCGTGCGACAATTTAA

Full Affymetrix probeset data:

Annotations for 1637989_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime