FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637992_at:

>probe:Drosophila_2:1637992_at:429:225; Interrogation_Position=1038; Antisense; AAGGAGCAGCTCATCTACAGTGTGT
>probe:Drosophila_2:1637992_at:554:331; Interrogation_Position=1104; Antisense; GCGGAATCCAAGTTGCGATCCTACG
>probe:Drosophila_2:1637992_at:382:717; Interrogation_Position=1116; Antisense; TTGCGATCCTACGAGCTGGAGGTTC
>probe:Drosophila_2:1637992_at:155:195; Interrogation_Position=1152; Antisense; AACTGCCTGGAGAACGCAACGCACG
>probe:Drosophila_2:1637992_at:187:219; Interrogation_Position=1188; Antisense; AAGGACGATCAGTTGGCCAGTTTGG
>probe:Drosophila_2:1637992_at:61:315; Interrogation_Position=1203; Antisense; GCCAGTTTGGGTGGAGCCCTGCAAA
>probe:Drosophila_2:1637992_at:195:99; Interrogation_Position=1235; Antisense; AGAGGAGTTGACTACGACGCGTATT
>probe:Drosophila_2:1637992_at:244:35; Interrogation_Position=1275; Antisense; ATCAGCGTGCTGACGGAGCAGGTCA
>probe:Drosophila_2:1637992_at:222:121; Interrogation_Position=1315; Antisense; AGCTGGCCGCCTGCAAATGAGCATG
>probe:Drosophila_2:1637992_at:364:57; Interrogation_Position=1331; Antisense; ATGAGCATGGACAGCGGCGCGCATC
>probe:Drosophila_2:1637992_at:674:299; Interrogation_Position=1357; Antisense; CGCCCAGCTGCTTTACTGTATATTG
>probe:Drosophila_2:1637992_at:539:279; Interrogation_Position=1416; Antisense; CTCTACCCTGTTTTGTTATTGTCCA
>probe:Drosophila_2:1637992_at:83:727; Interrogation_Position=1434; Antisense; TTGTCCACCCTCGACGTGTATATAA
>probe:Drosophila_2:1637992_at:426:111; Interrogation_Position=909; Antisense; AGCAAGGATCTCAGCACGTGCAGCT

Paste this into a BLAST search page for me
AAGGAGCAGCTCATCTACAGTGTGTGCGGAATCCAAGTTGCGATCCTACGTTGCGATCCTACGAGCTGGAGGTTCAACTGCCTGGAGAACGCAACGCACGAAGGACGATCAGTTGGCCAGTTTGGGCCAGTTTGGGTGGAGCCCTGCAAAAGAGGAGTTGACTACGACGCGTATTATCAGCGTGCTGACGGAGCAGGTCAAGCTGGCCGCCTGCAAATGAGCATGATGAGCATGGACAGCGGCGCGCATCCGCCCAGCTGCTTTACTGTATATTGCTCTACCCTGTTTTGTTATTGTCCATTGTCCACCCTCGACGTGTATATAAAGCAAGGATCTCAGCACGTGCAGCT

Full Affymetrix probeset data:

Annotations for 1637992_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720