Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637993_at:

>probe:Drosophila_2:1637993_at:89:89; Interrogation_Position=144; Antisense; AGTCGCAGCAGTTTCTCAAGAGTCT
>probe:Drosophila_2:1637993_at:639:277; Interrogation_Position=158; Antisense; CTCAAGAGTCTGTCCAGCGTGGAAT
>probe:Drosophila_2:1637993_at:473:285; Interrogation_Position=188; Antisense; CTGTCCGAGCAGATCAACTACTTGA
>probe:Drosophila_2:1637993_at:372:191; Interrogation_Position=203; Antisense; AACTACTTGACCCAGGTGTCCACGG
>probe:Drosophila_2:1637993_at:661:257; Interrogation_Position=234; Antisense; CACACGAGGGTTCCGGCTATGCATC
>probe:Drosophila_2:1637993_at:140:683; Interrogation_Position=251; Antisense; TATGCATCCGCCAAAGTGCTCCAAA
>probe:Drosophila_2:1637993_at:343:169; Interrogation_Position=273; Antisense; AAATGGCTTGGCATCGCATTCAGCA
>probe:Drosophila_2:1637993_at:714:273; Interrogation_Position=289; Antisense; CATTCAGCACGCTAGGTCCAGAGTG
>probe:Drosophila_2:1637993_at:113:657; Interrogation_Position=331; Antisense; TAAGGCCAAACACTCACATGCAGCT
>probe:Drosophila_2:1637993_at:174:145; Interrogation_Position=346; Antisense; ACATGCAGCTCGTCAGCAGTTGAAG
>probe:Drosophila_2:1637993_at:576:427; Interrogation_Position=501; Antisense; GAGATCATCCCATGGGCGGAGACTC
>probe:Drosophila_2:1637993_at:579:423; Interrogation_Position=519; Antisense; GAGACTCCTCAATGTCAACCAACTA
>probe:Drosophila_2:1637993_at:465:127; Interrogation_Position=536; Antisense; ACCAACTAATCTTGCGCTATCTTTA
>probe:Drosophila_2:1637993_at:191:565; Interrogation_Position=601; Antisense; GGCACATTTTGTCAACCAATTGCGT

Paste this into a BLAST search page for me
AGTCGCAGCAGTTTCTCAAGAGTCTCTCAAGAGTCTGTCCAGCGTGGAATCTGTCCGAGCAGATCAACTACTTGAAACTACTTGACCCAGGTGTCCACGGCACACGAGGGTTCCGGCTATGCATCTATGCATCCGCCAAAGTGCTCCAAAAAATGGCTTGGCATCGCATTCAGCACATTCAGCACGCTAGGTCCAGAGTGTAAGGCCAAACACTCACATGCAGCTACATGCAGCTCGTCAGCAGTTGAAGGAGATCATCCCATGGGCGGAGACTCGAGACTCCTCAATGTCAACCAACTAACCAACTAATCTTGCGCTATCTTTAGGCACATTTTGTCAACCAATTGCGT

Full Affymetrix probeset data:

Annotations for 1637993_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime