Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637994_at:

>probe:Drosophila_2:1637994_at:310:575; Interrogation_Position=2753; Antisense; GGCGTGCTCTTCAGCGCCAAGAAGA
>probe:Drosophila_2:1637994_at:447:375; Interrogation_Position=2773; Antisense; GAAGAGCGTACGACGATTCCAGTTC
>probe:Drosophila_2:1637994_at:730:407; Interrogation_Position=2784; Antisense; GACGATTCCAGTTCACCTACGAGGA
>probe:Drosophila_2:1637994_at:480:67; Interrogation_Position=2808; Antisense; AGGGAAACATTAGCAACGACGAGAC
>probe:Drosophila_2:1637994_at:222:137; Interrogation_Position=2823; Antisense; ACGACGAGACAGTGGGCGCCGACAA
>probe:Drosophila_2:1637994_at:538:437; Interrogation_Position=2864; Antisense; GAGGACATGTCGCTGGAAGCCTCCA
>probe:Drosophila_2:1637994_at:578:281; Interrogation_Position=2876; Antisense; CTGGAAGCCTCCACGGAAAGCGGAT
>probe:Drosophila_2:1637994_at:715:383; Interrogation_Position=2891; Antisense; GAAAGCGGATCCCTGGAACAGAATC
>probe:Drosophila_2:1637994_at:238:111; Interrogation_Position=2937; Antisense; AGAATGAAGCAACTCCTCGCACGTA
>probe:Drosophila_2:1637994_at:537:665; Interrogation_Position=2960; Antisense; TACACGCTGCGCAATCGGCGGGTGA
>probe:Drosophila_2:1637994_at:704:235; Interrogation_Position=2972; Antisense; AATCGGCGGGTGAATCTGCGTCCCT
>probe:Drosophila_2:1637994_at:615:503; Interrogation_Position=2991; Antisense; GTCCCTCCTCCGAGTTTATGTAGTT
>probe:Drosophila_2:1637994_at:460:399; Interrogation_Position=3025; Antisense; GACAGTAATTGTCCGTTGTGGAATT
>probe:Drosophila_2:1637994_at:400:229; Interrogation_Position=3143; Antisense; AATGTTCGACGAGTATGTTCTGTGA

Paste this into a BLAST search page for me
GGCGTGCTCTTCAGCGCCAAGAAGAGAAGAGCGTACGACGATTCCAGTTCGACGATTCCAGTTCACCTACGAGGAAGGGAAACATTAGCAACGACGAGACACGACGAGACAGTGGGCGCCGACAAGAGGACATGTCGCTGGAAGCCTCCACTGGAAGCCTCCACGGAAAGCGGATGAAAGCGGATCCCTGGAACAGAATCAGAATGAAGCAACTCCTCGCACGTATACACGCTGCGCAATCGGCGGGTGAAATCGGCGGGTGAATCTGCGTCCCTGTCCCTCCTCCGAGTTTATGTAGTTGACAGTAATTGTCCGTTGTGGAATTAATGTTCGACGAGTATGTTCTGTGA

Full Affymetrix probeset data:

Annotations for 1637994_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime