FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637998_at:

>probe:Drosophila_2:1637998_at:17:525; Interrogation_Position=189; Antisense; GGGAAATGGAAAGCCACCGCCTGCT
>probe:Drosophila_2:1637998_at:114:677; Interrogation_Position=229; Antisense; TATGGGCCACCACCCAAAAATGGCA
>probe:Drosophila_2:1637998_at:441:89; Interrogation_Position=271; Antisense; AGTAACGCATACTTGCCACCAGGCA
>probe:Drosophila_2:1637998_at:343:249; Interrogation_Position=294; Antisense; CAATGGCAATGGAGGATCTTCGGGA
>probe:Drosophila_2:1637998_at:489:533; Interrogation_Position=340; Antisense; GGTGGTGAGGATATACCCATCATTA
>probe:Drosophila_2:1637998_at:8:433; Interrogation_Position=370; Antisense; GAGTCCAAGGTCAACACCGATGGTT
>probe:Drosophila_2:1637998_at:444:259; Interrogation_Position=384; Antisense; CACCGATGGTTCTTATATGTACGAG
>probe:Drosophila_2:1637998_at:169:593; Interrogation_Position=443; Antisense; TGGGCTACTTGAAGAACGCCGGAGT
>probe:Drosophila_2:1637998_at:429:355; Interrogation_Position=481; Antisense; GCACAGACGGCGGAGGGTTCCTTTT
>probe:Drosophila_2:1637998_at:272:667; Interrogation_Position=508; Antisense; TACACCAGTCCCGAGGGCCAGGAAA
>probe:Drosophila_2:1637998_at:329:237; Interrogation_Position=531; Antisense; AATTTCACTGACCTACATTGCGGAC
>probe:Drosophila_2:1637998_at:475:715; Interrogation_Position=548; Antisense; TTGCGGACGAAAACGGATTCCAGCC
>probe:Drosophila_2:1637998_at:469:447; Interrogation_Position=653; Antisense; GATGCCATGGATGCGATGACAACGA
>probe:Drosophila_2:1637998_at:348:435; Interrogation_Position=704; Antisense; GAGGTGGCTATGTCTACCGACGAAA

Paste this into a BLAST search page for me
GGGAAATGGAAAGCCACCGCCTGCTTATGGGCCACCACCCAAAAATGGCAAGTAACGCATACTTGCCACCAGGCACAATGGCAATGGAGGATCTTCGGGAGGTGGTGAGGATATACCCATCATTAGAGTCCAAGGTCAACACCGATGGTTCACCGATGGTTCTTATATGTACGAGTGGGCTACTTGAAGAACGCCGGAGTGCACAGACGGCGGAGGGTTCCTTTTTACACCAGTCCCGAGGGCCAGGAAAAATTTCACTGACCTACATTGCGGACTTGCGGACGAAAACGGATTCCAGCCGATGCCATGGATGCGATGACAACGAGAGGTGGCTATGTCTACCGACGAAA

Full Affymetrix probeset data:

Annotations for 1637998_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720