FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638000_at:

>probe:Drosophila_2:1638000_at:377:429; Interrogation_Position=236; Antisense; GAGTCCACCCGGGTCAAGGAGGATT
>probe:Drosophila_2:1638000_at:626:541; Interrogation_Position=256; Antisense; GGATTCGCTGGACAAGGTTCTCCAA
>probe:Drosophila_2:1638000_at:529:541; Interrogation_Position=271; Antisense; GGTTCTCCAAACCAATATCAGCCTG
>probe:Drosophila_2:1638000_at:600:21; Interrogation_Position=285; Antisense; ATATCAGCCTGGTTACGGAAGTCCT
>probe:Drosophila_2:1638000_at:322:665; Interrogation_Position=298; Antisense; TACGGAAGTCCTGTGGGATCTGGCC
>probe:Drosophila_2:1638000_at:23:547; Interrogation_Position=313; Antisense; GGATCTGGCCATTTCCATGGAACTA
>probe:Drosophila_2:1638000_at:619:93; Interrogation_Position=342; Antisense; AGTTGAGTCCGGTCATTTTCACGAA
>probe:Drosophila_2:1638000_at:362:365; Interrogation_Position=376; Antisense; GAATATCCGGAACATCATGGCGATC
>probe:Drosophila_2:1638000_at:390:647; Interrogation_Position=390; Antisense; TCATGGCGATCATCACCGTGAACAT
>probe:Drosophila_2:1638000_at:527:493; Interrogation_Position=501; Antisense; GTAATGCTATAGTTCTCTACCGTAA
>probe:Drosophila_2:1638000_at:528:185; Interrogation_Position=536; Antisense; AACACTTGCTTGTTTCTGAAGTCTC
>probe:Drosophila_2:1638000_at:442:219; Interrogation_Position=554; Antisense; AAGTCTCTATTGTATCTAATGTCCA
>probe:Drosophila_2:1638000_at:552:425; Interrogation_Position=620; Antisense; GAGATCCACTATACAACGTGCCTTC
>probe:Drosophila_2:1638000_at:648:253; Interrogation_Position=633; Antisense; CAACGTGCCTTCTTGAATTTCAGTA

Paste this into a BLAST search page for me
GAGTCCACCCGGGTCAAGGAGGATTGGATTCGCTGGACAAGGTTCTCCAAGGTTCTCCAAACCAATATCAGCCTGATATCAGCCTGGTTACGGAAGTCCTTACGGAAGTCCTGTGGGATCTGGCCGGATCTGGCCATTTCCATGGAACTAAGTTGAGTCCGGTCATTTTCACGAAGAATATCCGGAACATCATGGCGATCTCATGGCGATCATCACCGTGAACATGTAATGCTATAGTTCTCTACCGTAAAACACTTGCTTGTTTCTGAAGTCTCAAGTCTCTATTGTATCTAATGTCCAGAGATCCACTATACAACGTGCCTTCCAACGTGCCTTCTTGAATTTCAGTA

Full Affymetrix probeset data:

Annotations for 1638000_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720