FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638002_at:

>probe:Drosophila_2:1638002_at:672:37; Interrogation_Position=322; Antisense; ATCTTCGTCCATCCAGGGTACGAGC
>probe:Drosophila_2:1638002_at:647:217; Interrogation_Position=355; Antisense; AAGTACGTCAACGACATCGCATTGT
>probe:Drosophila_2:1638002_at:660:5; Interrogation_Position=375; Antisense; ATTGTTGCAGTTAGCGCAGTCCGTC
>probe:Drosophila_2:1638002_at:197:349; Interrogation_Position=390; Antisense; GCAGTCCGTCGCTTTGAGCAAGTTT
>probe:Drosophila_2:1638002_at:216:609; Interrogation_Position=404; Antisense; TGAGCAAGTTTGTCCAGCCGGTGCG
>probe:Drosophila_2:1638002_at:112:115; Interrogation_Position=515; Antisense; AGCAGCATCTGCAGAAGGTCAAACT
>probe:Drosophila_2:1638002_at:400:221; Interrogation_Position=542; Antisense; AAGTGTTCAGCGATACCGAGTGCAG
>probe:Drosophila_2:1638002_at:627:125; Interrogation_Position=595; Antisense; AGCCAGATCTGTGCGGGATTGCCCG
>probe:Drosophila_2:1638002_at:155:703; Interrogation_Position=668; Antisense; TTATTGGCTCCGACACCCAGGTGGG
>probe:Drosophila_2:1638002_at:633:79; Interrogation_Position=686; Antisense; AGGTGGGCATTGTTTCTTGGAGCAT
>probe:Drosophila_2:1638002_at:175:729; Interrogation_Position=702; Antisense; TTGGAGCATAAAGCCCTGTGCACGG
>probe:Drosophila_2:1638002_at:389:499; Interrogation_Position=756; Antisense; GTCGGCCTACGTGGACTGGATTGTA
>probe:Drosophila_2:1638002_at:694:423; Interrogation_Position=781; Antisense; GAGACGGTAAATAGCTATTCGCCCC
>probe:Drosophila_2:1638002_at:620:577; Interrogation_Position=823; Antisense; GGCCAGCTGATTGTGGGACGATCCC

Paste this into a BLAST search page for me
ATCTTCGTCCATCCAGGGTACGAGCAAGTACGTCAACGACATCGCATTGTATTGTTGCAGTTAGCGCAGTCCGTCGCAGTCCGTCGCTTTGAGCAAGTTTTGAGCAAGTTTGTCCAGCCGGTGCGAGCAGCATCTGCAGAAGGTCAAACTAAGTGTTCAGCGATACCGAGTGCAGAGCCAGATCTGTGCGGGATTGCCCGTTATTGGCTCCGACACCCAGGTGGGAGGTGGGCATTGTTTCTTGGAGCATTTGGAGCATAAAGCCCTGTGCACGGGTCGGCCTACGTGGACTGGATTGTAGAGACGGTAAATAGCTATTCGCCCCGGCCAGCTGATTGTGGGACGATCCC

Full Affymetrix probeset data:

Annotations for 1638002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720