FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638003_at:

>probe:Drosophila_2:1638003_at:112:727; Interrogation_Position=1669; Antisense; TTGTATCCGTACTCCAAGCTGCTGG
>probe:Drosophila_2:1638003_at:237:165; Interrogation_Position=1696; Antisense; AAATCGCCCTCAGTGTTGCAGGGAG
>probe:Drosophila_2:1638003_at:567:81; Interrogation_Position=1715; Antisense; AGGGAGCCCTCTACTATACACTGGT
>probe:Drosophila_2:1638003_at:670:337; Interrogation_Position=1793; Antisense; GCTATGGTAGTCTGGCCAACAGCTT
>probe:Drosophila_2:1638003_at:95:259; Interrogation_Position=1876; Antisense; CACATCTTTGTCGTGGAAGTCGCCA
>probe:Drosophila_2:1638003_at:179:473; Interrogation_Position=1909; Antisense; GTTCAGACCAATACGTACTTCTCCA
>probe:Drosophila_2:1638003_at:407:85; Interrogation_Position=1941; Antisense; AGTGATGCTCAACTTTTGGTCCACC
>probe:Drosophila_2:1638003_at:423:717; Interrogation_Position=1967; Antisense; TTGGCTTTACCCTGCTGATGTCCTA
>probe:Drosophila_2:1638003_at:699:59; Interrogation_Position=1984; Antisense; ATGTCCTACGTGCTCTACGTTTTAA
>probe:Drosophila_2:1638003_at:609:277; Interrogation_Position=1998; Antisense; CTACGTTTTAATTGAGGCGCCTCTG
>probe:Drosophila_2:1638003_at:602:209; Interrogation_Position=2034; Antisense; AAGAATTATGTTTCCCAATCGCAGA
>probe:Drosophila_2:1638003_at:54:455; Interrogation_Position=2077; Antisense; GATCAGCTGCATATCGAGTCCCGAA
>probe:Drosophila_2:1638003_at:725:377; Interrogation_Position=2169; Antisense; GAAGCGCAGTGATATCCAGCCTGAC
>probe:Drosophila_2:1638003_at:36:425; Interrogation_Position=2218; Antisense; GAGACTGACCTCGAGTTATCAAATT

Paste this into a BLAST search page for me
TTGTATCCGTACTCCAAGCTGCTGGAAATCGCCCTCAGTGTTGCAGGGAGAGGGAGCCCTCTACTATACACTGGTGCTATGGTAGTCTGGCCAACAGCTTCACATCTTTGTCGTGGAAGTCGCCAGTTCAGACCAATACGTACTTCTCCAAGTGATGCTCAACTTTTGGTCCACCTTGGCTTTACCCTGCTGATGTCCTAATGTCCTACGTGCTCTACGTTTTAACTACGTTTTAATTGAGGCGCCTCTGAAGAATTATGTTTCCCAATCGCAGAGATCAGCTGCATATCGAGTCCCGAAGAAGCGCAGTGATATCCAGCCTGACGAGACTGACCTCGAGTTATCAAATT

Full Affymetrix probeset data:

Annotations for 1638003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720