FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638004_at:

>probe:Drosophila_2:1638004_at:723:473; Interrogation_Position=2137; Antisense; GTTAACCAACAACGCTACGAACTAT
>probe:Drosophila_2:1638004_at:370:599; Interrogation_Position=2166; Antisense; TGTTCTTTCAAGGTGCTATAGCTAT
>probe:Drosophila_2:1638004_at:544:401; Interrogation_Position=2204; Antisense; GACTTGTTTCGATACGTATTCCCTT
>probe:Drosophila_2:1638004_at:635:301; Interrogation_Position=2224; Antisense; CCCTTCTCCATCTGTTATCATTGTA
>probe:Drosophila_2:1638004_at:139:37; Interrogation_Position=2240; Antisense; ATCATTGTATTCTTTCGAAACCTAA
>probe:Drosophila_2:1638004_at:585:3; Interrogation_Position=2314; Antisense; ATTGTTCCAATCCTGAAACGCTCTT
>probe:Drosophila_2:1638004_at:332:531; Interrogation_Position=2324; Antisense; TCCTGAAACGCTCTTTGCCCAAAGA
>probe:Drosophila_2:1638004_at:53:463; Interrogation_Position=2347; Antisense; GATTCACTTTTAGAGCCATAGTCAT
>probe:Drosophila_2:1638004_at:611:395; Interrogation_Position=2372; Antisense; GAAATAGATCAATTCCATCGCCTTT
>probe:Drosophila_2:1638004_at:695:391; Interrogation_Position=2403; Antisense; GAAACCCTGAGTAAAGATGCCATGC
>probe:Drosophila_2:1638004_at:606:447; Interrogation_Position=2418; Antisense; GATGCCATGCAACAAAATGCCAACT
>probe:Drosophila_2:1638004_at:536:459; Interrogation_Position=2506; Antisense; GATATTGTTCAAAACCACATGCATG
>probe:Drosophila_2:1638004_at:455:123; Interrogation_Position=2519; Antisense; ACCACATGCATGTAAAGCTTCGAAA
>probe:Drosophila_2:1638004_at:509:93; Interrogation_Position=2534; Antisense; AGCTTCGAAACGGACTTTCTCTATA

Paste this into a BLAST search page for me
GTTAACCAACAACGCTACGAACTATTGTTCTTTCAAGGTGCTATAGCTATGACTTGTTTCGATACGTATTCCCTTCCCTTCTCCATCTGTTATCATTGTAATCATTGTATTCTTTCGAAACCTAAATTGTTCCAATCCTGAAACGCTCTTTCCTGAAACGCTCTTTGCCCAAAGAGATTCACTTTTAGAGCCATAGTCATGAAATAGATCAATTCCATCGCCTTTGAAACCCTGAGTAAAGATGCCATGCGATGCCATGCAACAAAATGCCAACTGATATTGTTCAAAACCACATGCATGACCACATGCATGTAAAGCTTCGAAAAGCTTCGAAACGGACTTTCTCTATA

Full Affymetrix probeset data:

Annotations for 1638004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720