Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638006_at:

>probe:Drosophila_2:1638006_at:170:509; Interrogation_Position=4461; Antisense; GTGCTGCCTTTGATTTGCCTAGCAA
>probe:Drosophila_2:1638006_at:581:675; Interrogation_Position=4480; Antisense; TAGCAATTTCCTTAACCCACGTGTG
>probe:Drosophila_2:1638006_at:533:95; Interrogation_Position=4524; Antisense; AGATTGACCTGAATGCCTGGCGCGA
>probe:Drosophila_2:1638006_at:512:465; Interrogation_Position=4567; Antisense; GATTGGCAACCGCAATGTCCGAGTT
>probe:Drosophila_2:1638006_at:162:429; Interrogation_Position=4587; Antisense; GAGTTGGAGAATCTGCCTTCCCATC
>probe:Drosophila_2:1638006_at:215:225; Interrogation_Position=4641; Antisense; AAGGAGCTCAGTGTGCGTCTCTGCG
>probe:Drosophila_2:1638006_at:647:345; Interrogation_Position=4665; Antisense; GCATCACGGATTGCGGCCAGTTGAT
>probe:Drosophila_2:1638006_at:158:213; Interrogation_Position=4704; Antisense; AAGAGGCTATTCTCCGTGACGAGGT
>probe:Drosophila_2:1638006_at:404:597; Interrogation_Position=4728; Antisense; TGTGCAACTCGCAGTGCGGCATTTA
>probe:Drosophila_2:1638006_at:321:623; Interrogation_Position=4742; Antisense; TGCGGCATTTATTTGACTGGTCAGC
>probe:Drosophila_2:1638006_at:384:591; Interrogation_Position=4759; Antisense; TGGTCAGCAGGCCAGTGGCTTCAAT
>probe:Drosophila_2:1638006_at:85:239; Interrogation_Position=4832; Antisense; AATCAGAATCTCTTCAAGTTCCCCG
>probe:Drosophila_2:1638006_at:366:713; Interrogation_Position=4868; Antisense; TTCATTGCTTCCCTGTAAGCTGGAG
>probe:Drosophila_2:1638006_at:600:365; Interrogation_Position=4925; Antisense; GAATCATCAACTTTGGGTGCGGAGT

Paste this into a BLAST search page for me
GTGCTGCCTTTGATTTGCCTAGCAATAGCAATTTCCTTAACCCACGTGTGAGATTGACCTGAATGCCTGGCGCGAGATTGGCAACCGCAATGTCCGAGTTGAGTTGGAGAATCTGCCTTCCCATCAAGGAGCTCAGTGTGCGTCTCTGCGGCATCACGGATTGCGGCCAGTTGATAAGAGGCTATTCTCCGTGACGAGGTTGTGCAACTCGCAGTGCGGCATTTATGCGGCATTTATTTGACTGGTCAGCTGGTCAGCAGGCCAGTGGCTTCAATAATCAGAATCTCTTCAAGTTCCCCGTTCATTGCTTCCCTGTAAGCTGGAGGAATCATCAACTTTGGGTGCGGAGT

Full Affymetrix probeset data:

Annotations for 1638006_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime