Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638007_at:

>probe:Drosophila_2:1638007_at:611:169; Interrogation_Position=1001; Antisense; AAAGGCAGGTGCTTCGGTCAACAAG
>probe:Drosophila_2:1638007_at:13:571; Interrogation_Position=1027; Antisense; GGCTTGGCAAATCGCGACGCATTAA
>probe:Drosophila_2:1638007_at:507:519; Interrogation_Position=1058; Antisense; GGGCAGAAAGTAATCCCCGGGACTG
>probe:Drosophila_2:1638007_at:596:303; Interrogation_Position=1074; Antisense; CCGGGACTGCCGACTATATTTAGGT
>probe:Drosophila_2:1638007_at:541:615; Interrogation_Position=1173; Antisense; TGCACACAGCCTTACTTTCGAAATG
>probe:Drosophila_2:1638007_at:679:399; Interrogation_Position=673; Antisense; GACAGGCGAAATCCGAGCGCATCAA
>probe:Drosophila_2:1638007_at:212:447; Interrogation_Position=728; Antisense; GATGCTGGCCAAACAGACCAAGGTC
>probe:Drosophila_2:1638007_at:462:123; Interrogation_Position=744; Antisense; ACCAAGGTCCAACGCGAAGCCGAGA
>probe:Drosophila_2:1638007_at:724:609; Interrogation_Position=814; Antisense; TGAAAAACCTGGACTTCCTGGAGGA
>probe:Drosophila_2:1638007_at:672:409; Interrogation_Position=837; Antisense; GACGCCAAGGCGCTTGAGTCCAAGC
>probe:Drosophila_2:1638007_at:572:261; Interrogation_Position=861; Antisense; CAGAAGCAGTCAGCCGAGAATCGCA
>probe:Drosophila_2:1638007_at:214:211; Interrogation_Position=897; Antisense; AAGAAGTTCGGCTTCGGCGGCAAGA
>probe:Drosophila_2:1638007_at:639:255; Interrogation_Position=943; Antisense; CAAAGTCCTCCTCCGCGGGATTGGA
>probe:Drosophila_2:1638007_at:708:463; Interrogation_Position=961; Antisense; GATTGGATGGCGACAAGTCCTCCAG

Paste this into a BLAST search page for me
AAAGGCAGGTGCTTCGGTCAACAAGGGCTTGGCAAATCGCGACGCATTAAGGGCAGAAAGTAATCCCCGGGACTGCCGGGACTGCCGACTATATTTAGGTTGCACACAGCCTTACTTTCGAAATGGACAGGCGAAATCCGAGCGCATCAAGATGCTGGCCAAACAGACCAAGGTCACCAAGGTCCAACGCGAAGCCGAGATGAAAAACCTGGACTTCCTGGAGGAGACGCCAAGGCGCTTGAGTCCAAGCCAGAAGCAGTCAGCCGAGAATCGCAAAGAAGTTCGGCTTCGGCGGCAAGACAAAGTCCTCCTCCGCGGGATTGGAGATTGGATGGCGACAAGTCCTCCAG

Full Affymetrix probeset data:

Annotations for 1638007_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime