Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638009_s_at:

>probe:Drosophila_2:1638009_s_at:580:441; Interrogation_Position=1054; Antisense; GATGTGGCCCAACATGGTGGCCCAA
>probe:Drosophila_2:1638009_s_at:623:321; Interrogation_Position=1073; Antisense; GCCCAACAATGGGTTATATTCAGTA
>probe:Drosophila_2:1638009_s_at:452:681; Interrogation_Position=743; Antisense; TATCGAATCGAATACCGGTGCTGTC
>probe:Drosophila_2:1638009_s_at:560:535; Interrogation_Position=759; Antisense; GGTGCTGTCCCCTTTATATAGACTT
>probe:Drosophila_2:1638009_s_at:562:401; Interrogation_Position=779; Antisense; GACTTTAATCGAACTTTTATGTACA
>probe:Drosophila_2:1638009_s_at:480:599; Interrogation_Position=798; Antisense; TGTACATACAAATCCCACAACGCGC
>probe:Drosophila_2:1638009_s_at:619:631; Interrogation_Position=810; Antisense; TCCCACAACGCGCAACGTAAACGAA
>probe:Drosophila_2:1638009_s_at:8:379; Interrogation_Position=846; Antisense; GAAGCTGTACTAGCAGATCGCGAAA
>probe:Drosophila_2:1638009_s_at:527:449; Interrogation_Position=861; Antisense; GATCGCGAAACTGCGTTTTACAACC
>probe:Drosophila_2:1638009_s_at:215:597; Interrogation_Position=872; Antisense; TGCGTTTTACAACCTGTTAACCATT
>probe:Drosophila_2:1638009_s_at:13:689; Interrogation_Position=899; Antisense; TATTTATGGTTCACCGCCTTATCGA
>probe:Drosophila_2:1638009_s_at:175:133; Interrogation_Position=911; Antisense; ACCGCCTTATCGACGTGATTCGTAT
>probe:Drosophila_2:1638009_s_at:380:467; Interrogation_Position=943; Antisense; GTTGTAACTGTGGAGGCTTTGCGTA
>probe:Drosophila_2:1638009_s_at:705:423; Interrogation_Position=955; Antisense; GAGGCTTTGCGTATAGTTAAATCGA

Paste this into a BLAST search page for me
GATGTGGCCCAACATGGTGGCCCAAGCCCAACAATGGGTTATATTCAGTATATCGAATCGAATACCGGTGCTGTCGGTGCTGTCCCCTTTATATAGACTTGACTTTAATCGAACTTTTATGTACATGTACATACAAATCCCACAACGCGCTCCCACAACGCGCAACGTAAACGAAGAAGCTGTACTAGCAGATCGCGAAAGATCGCGAAACTGCGTTTTACAACCTGCGTTTTACAACCTGTTAACCATTTATTTATGGTTCACCGCCTTATCGAACCGCCTTATCGACGTGATTCGTATGTTGTAACTGTGGAGGCTTTGCGTAGAGGCTTTGCGTATAGTTAAATCGA

Full Affymetrix probeset data:

Annotations for 1638009_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime