Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638012_at:

>probe:Drosophila_2:1638012_at:56:575; Interrogation_Position=2697; Antisense; GGCGGCAACGTCTTTGCTTTGATAT
>probe:Drosophila_2:1638012_at:587:461; Interrogation_Position=2742; Antisense; GATTCGTATTAGCTGGTGACACCTT
>probe:Drosophila_2:1638012_at:359:497; Interrogation_Position=2757; Antisense; GTGACACCTTTTTTATGGGCTACGT
>probe:Drosophila_2:1638012_at:456:291; Interrogation_Position=2779; Antisense; CGTGATGCACTATATTCCGTATTTT
>probe:Drosophila_2:1638012_at:63:691; Interrogation_Position=2802; Antisense; TTTGTGTGGATCGTACACTCTTCCT
>probe:Drosophila_2:1638012_at:707:665; Interrogation_Position=2815; Antisense; TACACTCTTCCTGCACAATTACTTG
>probe:Drosophila_2:1638012_at:726:245; Interrogation_Position=2831; Antisense; AATTACTTGCCAGCCTTTGTGTTTA
>probe:Drosophila_2:1638012_at:95:19; Interrogation_Position=2886; Antisense; ATTTGGACTATCTGCTCAGGCGCTT
>probe:Drosophila_2:1638012_at:456:705; Interrogation_Position=2944; Antisense; TTATCGCCTCATGCTAATCCTGTGG
>probe:Drosophila_2:1638012_at:725:517; Interrogation_Position=2972; Antisense; GTGGGCGTGCTTAGCATTTTCTCAA
>probe:Drosophila_2:1638012_at:8:59; Interrogation_Position=3039; Antisense; ATGAGGTTCGCAGTCTTCGATGGAA
>probe:Drosophila_2:1638012_at:273:71; Interrogation_Position=3063; Antisense; AGGATACCTGGGACTTTGTCCTGCA
>probe:Drosophila_2:1638012_at:728:251; Interrogation_Position=3088; Antisense; CAAGAACCACCACCTGTACTGAAAA
>probe:Drosophila_2:1638012_at:523:303; Interrogation_Position=3127; Antisense; CCGCGGCCAGAGAGAGACGTGCAAT

Paste this into a BLAST search page for me
GGCGGCAACGTCTTTGCTTTGATATGATTCGTATTAGCTGGTGACACCTTGTGACACCTTTTTTATGGGCTACGTCGTGATGCACTATATTCCGTATTTTTTTGTGTGGATCGTACACTCTTCCTTACACTCTTCCTGCACAATTACTTGAATTACTTGCCAGCCTTTGTGTTTAATTTGGACTATCTGCTCAGGCGCTTTTATCGCCTCATGCTAATCCTGTGGGTGGGCGTGCTTAGCATTTTCTCAAATGAGGTTCGCAGTCTTCGATGGAAAGGATACCTGGGACTTTGTCCTGCACAAGAACCACCACCTGTACTGAAAACCGCGGCCAGAGAGAGACGTGCAAT

Full Affymetrix probeset data:

Annotations for 1638012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime