FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638013_at:

>probe:Drosophila_2:1638013_at:116:681; Interrogation_Position=541; Antisense; TATGGTCAATTCAGTCGGATCCTAC
>probe:Drosophila_2:1638013_at:165:449; Interrogation_Position=558; Antisense; GATCCTACTGAATGCCACTCTATAT
>probe:Drosophila_2:1638013_at:41:257; Interrogation_Position=618; Antisense; CAAACAGGCTGATCGATCGCAGATA
>probe:Drosophila_2:1638013_at:574:43; Interrogation_Position=633; Antisense; ATCGCAGATATGTGCTGGCAGTCAT
>probe:Drosophila_2:1638013_at:168:569; Interrogation_Position=649; Antisense; GGCAGTCATACCAGTAACACCTGTA
>probe:Drosophila_2:1638013_at:447:11; Interrogation_Position=680; Antisense; ATTCTGGAGGCCCATTGAGCTCGAA
>probe:Drosophila_2:1638013_at:345:565; Interrogation_Position=715; Antisense; GGCAACAGGCTTCTGAGTTTCCAGT
>probe:Drosophila_2:1638013_at:711:427; Interrogation_Position=729; Antisense; GAGTTTCCAGTACGGCTTGGTCAGC
>probe:Drosophila_2:1638013_at:402:343; Interrogation_Position=743; Antisense; GCTTGGTCAGCTACGGATCCGAAAG
>probe:Drosophila_2:1638013_at:81:297; Interrogation_Position=771; Antisense; CGCGGCTAATGTGGCAGGTGTTTAC
>probe:Drosophila_2:1638013_at:45:667; Interrogation_Position=793; Antisense; TACACCAATGTATCGTACCACAGGG
>probe:Drosophila_2:1638013_at:293:537; Interrogation_Position=856; Antisense; GGTCATACTACCTTTTGGTTATCCA
>probe:Drosophila_2:1638013_at:723:539; Interrogation_Position=872; Antisense; GGTTATCCAAGCTCGTAGGCCAAAC
>probe:Drosophila_2:1638013_at:253:67; Interrogation_Position=979; Antisense; ATGGCAGGGCAACGCATCGAAGTTC

Paste this into a BLAST search page for me
TATGGTCAATTCAGTCGGATCCTACGATCCTACTGAATGCCACTCTATATCAAACAGGCTGATCGATCGCAGATAATCGCAGATATGTGCTGGCAGTCATGGCAGTCATACCAGTAACACCTGTAATTCTGGAGGCCCATTGAGCTCGAAGGCAACAGGCTTCTGAGTTTCCAGTGAGTTTCCAGTACGGCTTGGTCAGCGCTTGGTCAGCTACGGATCCGAAAGCGCGGCTAATGTGGCAGGTGTTTACTACACCAATGTATCGTACCACAGGGGGTCATACTACCTTTTGGTTATCCAGGTTATCCAAGCTCGTAGGCCAAACATGGCAGGGCAACGCATCGAAGTTC

Full Affymetrix probeset data:

Annotations for 1638013_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720