FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638014_at:

>probe:Drosophila_2:1638014_at:151:213; Interrogation_Position=1476; Antisense; GAAGACGTTCTAGGTCAAGGGACCA
>probe:Drosophila_2:1638014_at:650:373; Interrogation_Position=1509; Antisense; GAAGACGCTCTAGGCCAAGGGAACA
>probe:Drosophila_2:1638014_at:221:359; Interrogation_Position=1599; Antisense; GCAATGACAGCAGGCGATTCCATTC
>probe:Drosophila_2:1638014_at:207:451; Interrogation_Position=1653; Antisense; GATCGCATAGAGAAACCTCCAGGAA
>probe:Drosophila_2:1638014_at:110:215; Interrogation_Position=1684; Antisense; AAGATCGCCAGAGCGGAGGCAACAA
>probe:Drosophila_2:1638014_at:44:3; Interrogation_Position=1705; Antisense; ACAATCCAGGAACCGGGAAGACCAT
>probe:Drosophila_2:1638014_at:441:675; Interrogation_Position=1729; Antisense; TAGAATGGACACTCACTCAAGCCCT
>probe:Drosophila_2:1638014_at:374:251; Interrogation_Position=1746; Antisense; CAAGCCCTAACAAGAGTCATGAGAA
>probe:Drosophila_2:1638014_at:653:117; Interrogation_Position=1828; Antisense; AGCTAGCAGCAGTTCAGATTCGAGT
>probe:Drosophila_2:1638014_at:60:433; Interrogation_Position=1849; Antisense; GAGTGAAAGTTCCTCGGAATCCGAA
>probe:Drosophila_2:1638014_at:237:639; Interrogation_Position=1862; Antisense; TCGGAATCCGAAAGCGACTCCACAT
>probe:Drosophila_2:1638014_at:709:205; Interrogation_Position=1873; Antisense; AAGCGACTCCACATCTTCAGATAGT
>probe:Drosophila_2:1638014_at:730:673; Interrogation_Position=1894; Antisense; TAGTTCCGAGGACAGCTCTAGCAGC
>probe:Drosophila_2:1638014_at:9:501; Interrogation_Position=1927; Antisense; GTCGGACGATCGCAGCAAACGCAAA

Paste this into a BLAST search page for me
GAAGACGTTCTAGGTCAAGGGACCAGAAGACGCTCTAGGCCAAGGGAACAGCAATGACAGCAGGCGATTCCATTCGATCGCATAGAGAAACCTCCAGGAAAAGATCGCCAGAGCGGAGGCAACAAACAATCCAGGAACCGGGAAGACCATTAGAATGGACACTCACTCAAGCCCTCAAGCCCTAACAAGAGTCATGAGAAAGCTAGCAGCAGTTCAGATTCGAGTGAGTGAAAGTTCCTCGGAATCCGAATCGGAATCCGAAAGCGACTCCACATAAGCGACTCCACATCTTCAGATAGTTAGTTCCGAGGACAGCTCTAGCAGCGTCGGACGATCGCAGCAAACGCAAA

Full Affymetrix probeset data:

Annotations for 1638014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720