FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638016_at:

>probe:Drosophila_2:1638016_at:547:301; Interrogation_Position=2348; Antisense; CCCGGTAGTGATGATTCCAATGAAT
>probe:Drosophila_2:1638016_at:608:613; Interrogation_Position=2368; Antisense; TGAATCCGACACATAAACCACCCAT
>probe:Drosophila_2:1638016_at:354:613; Interrogation_Position=2461; Antisense; TGAATGGCTGAGTGGCTTTTTCTGT
>probe:Drosophila_2:1638016_at:466:607; Interrogation_Position=2469; Antisense; TGAGTGGCTTTTTCTGTGTTCTTTT
>probe:Drosophila_2:1638016_at:245:691; Interrogation_Position=2495; Antisense; TATTCCTTTTCCTAATAGTAGTTAG
>probe:Drosophila_2:1638016_at:1:253; Interrogation_Position=2550; Antisense; CAAGTAATGAGATCAAGTGCGCAGA
>probe:Drosophila_2:1638016_at:142:507; Interrogation_Position=2566; Antisense; GTGCGCAGAGATACAATTCATTCAA
>probe:Drosophila_2:1638016_at:297:641; Interrogation_Position=2583; Antisense; TCATTCAACTTTGTCCGCCTAAAAC
>probe:Drosophila_2:1638016_at:179:259; Interrogation_Position=2626; Antisense; CACTACAATTTGTACTTGTCTGATA
>probe:Drosophila_2:1638016_at:24:93; Interrogation_Position=2694; Antisense; AGTTTATTGTTGTCCTTGATCCGAG
>probe:Drosophila_2:1638016_at:44:599; Interrogation_Position=2704; Antisense; TGTCCTTGATCCGAGTGTCTGTTAA
>probe:Drosophila_2:1638016_at:530:83; Interrogation_Position=2717; Antisense; AGTGTCTGTTAAGCCTATCTCATTT
>probe:Drosophila_2:1638016_at:255:367; Interrogation_Position=2747; Antisense; GAATCTCATTACTTAGTTGTCAATA
>probe:Drosophila_2:1638016_at:447:713; Interrogation_Position=2828; Antisense; TTGCACGTTTTATTCCATTACCCTT

Paste this into a BLAST search page for me
CCCGGTAGTGATGATTCCAATGAATTGAATCCGACACATAAACCACCCATTGAATGGCTGAGTGGCTTTTTCTGTTGAGTGGCTTTTTCTGTGTTCTTTTTATTCCTTTTCCTAATAGTAGTTAGCAAGTAATGAGATCAAGTGCGCAGAGTGCGCAGAGATACAATTCATTCAATCATTCAACTTTGTCCGCCTAAAACCACTACAATTTGTACTTGTCTGATAAGTTTATTGTTGTCCTTGATCCGAGTGTCCTTGATCCGAGTGTCTGTTAAAGTGTCTGTTAAGCCTATCTCATTTGAATCTCATTACTTAGTTGTCAATATTGCACGTTTTATTCCATTACCCTT

Full Affymetrix probeset data:

Annotations for 1638016_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720