FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638017_at:

>probe:Drosophila_2:1638017_at:528:581; Interrogation_Position=131; Antisense; TGGCCATTCTCGAATCATCTCACGA
>probe:Drosophila_2:1638017_at:432:77; Interrogation_Position=164; Antisense; AGGATGGATCGTACAACTTCTCTTA
>probe:Drosophila_2:1638017_at:45:191; Interrogation_Position=178; Antisense; AACTTCTCTTACCTCGGCGAGGACG
>probe:Drosophila_2:1638017_at:507:299; Interrogation_Position=21; Antisense; CCCTCCAGACAGCAGCATGTTTAAG
>probe:Drosophila_2:1638017_at:654:565; Interrogation_Position=241; Antisense; GGCACCGAGAACGAGTACCTGGAGA
>probe:Drosophila_2:1638017_at:236:91; Interrogation_Position=254; Antisense; AGTACCTGGAGATCAGCGGCTCCTA
>probe:Drosophila_2:1638017_at:463:147; Interrogation_Position=284; Antisense; ACTTCGATGCCAACGGACAGGAGGT
>probe:Drosophila_2:1638017_at:485:533; Interrogation_Position=306; Antisense; GGTGACCGTCACCTACAAGGCCGAT
>probe:Drosophila_2:1638017_at:319:445; Interrogation_Position=328; Antisense; GATGACCACGGATTTGTACCAGAGG
>probe:Drosophila_2:1638017_at:266:673; Interrogation_Position=344; Antisense; TACCAGAGGGCGGAGCAATCCTGCC
>probe:Drosophila_2:1638017_at:398:601; Interrogation_Position=38; Antisense; TGTTTAAGATTCTCATCGTCGCCCT
>probe:Drosophila_2:1638017_at:302:507; Interrogation_Position=406; Antisense; GTGCCCCAACCAGATCTTGACTATG
>probe:Drosophila_2:1638017_at:387:721; Interrogation_Position=422; Antisense; TTGACTATGCTAAGCCTCCTAAGGT
>probe:Drosophila_2:1638017_at:487:639; Interrogation_Position=80; Antisense; TCGTGCTGAGTGCTCCAGTGGACCA

Paste this into a BLAST search page for me
TGGCCATTCTCGAATCATCTCACGAAGGATGGATCGTACAACTTCTCTTAAACTTCTCTTACCTCGGCGAGGACGCCCTCCAGACAGCAGCATGTTTAAGGGCACCGAGAACGAGTACCTGGAGAAGTACCTGGAGATCAGCGGCTCCTAACTTCGATGCCAACGGACAGGAGGTGGTGACCGTCACCTACAAGGCCGATGATGACCACGGATTTGTACCAGAGGTACCAGAGGGCGGAGCAATCCTGCCTGTTTAAGATTCTCATCGTCGCCCTGTGCCCCAACCAGATCTTGACTATGTTGACTATGCTAAGCCTCCTAAGGTTCGTGCTGAGTGCTCCAGTGGACCA

Full Affymetrix probeset data:

Annotations for 1638017_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720