Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638020_at:

>probe:Drosophila_2:1638020_at:568:577; Interrogation_Position=1023; Antisense; GGCCGTATCACACCCGTAGAGGGAA
>probe:Drosophila_2:1638020_at:470:19; Interrogation_Position=1052; Antisense; ATTTGATTTACGTGTGTCCAGCAAT
>probe:Drosophila_2:1638020_at:574:261; Interrogation_Position=1070; Antisense; CAGCAATCTGGGTGAACGCCTCAAG
>probe:Drosophila_2:1638020_at:426:445; Interrogation_Position=1119; Antisense; GATGACAACTTCTGTGTGACCTTCA
>probe:Drosophila_2:1638020_at:299:81; Interrogation_Position=1207; Antisense; AGGTGGTCAGCAATCAGCCCGGAGT
>probe:Drosophila_2:1638020_at:638:127; Interrogation_Position=1242; Antisense; ACCTCCAACTTTATGCCAGACGTGG
>probe:Drosophila_2:1638020_at:340:139; Interrogation_Position=1261; Antisense; ACGTGGAACGCGGTGAATCGCCCAT
>probe:Drosophila_2:1638020_at:619:547; Interrogation_Position=1295; Antisense; GGATGGAGCTGCCTATGCCAAGCAT
>probe:Drosophila_2:1638020_at:323:209; Interrogation_Position=1314; Antisense; AAGCATTGTGCCTTCTGCCTGGAGA
>probe:Drosophila_2:1638020_at:348:423; Interrogation_Position=1335; Antisense; GAGACACAAAAGTTTCCCGACTCCG
>probe:Drosophila_2:1638020_at:628:411; Interrogation_Position=1382; Antisense; GACCATTTTGCGACCTGGCGAAAGT
>probe:Drosophila_2:1638020_at:376:475; Interrogation_Position=1405; Antisense; GTTACCAGCACGAAGTCATCTACAA
>probe:Drosophila_2:1638020_at:287:159; Interrogation_Position=1426; Antisense; ACAAGTTCGGAGTTTCTCACTGAGT
>probe:Drosophila_2:1638020_at:147:597; Interrogation_Position=1489; Antisense; TGTATCCGACTATTCAAGCAACCCG

Paste this into a BLAST search page for me
GGCCGTATCACACCCGTAGAGGGAAATTTGATTTACGTGTGTCCAGCAATCAGCAATCTGGGTGAACGCCTCAAGGATGACAACTTCTGTGTGACCTTCAAGGTGGTCAGCAATCAGCCCGGAGTACCTCCAACTTTATGCCAGACGTGGACGTGGAACGCGGTGAATCGCCCATGGATGGAGCTGCCTATGCCAAGCATAAGCATTGTGCCTTCTGCCTGGAGAGAGACACAAAAGTTTCCCGACTCCGGACCATTTTGCGACCTGGCGAAAGTGTTACCAGCACGAAGTCATCTACAAACAAGTTCGGAGTTTCTCACTGAGTTGTATCCGACTATTCAAGCAACCCG

Full Affymetrix probeset data:

Annotations for 1638020_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime