FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638021_at:

>probe:Drosophila_2:1638021_at:384:333; Interrogation_Position=1206; Antisense; GCTGGAGTACCCGAAATCACTTAAG
>probe:Drosophila_2:1638021_at:137:533; Interrogation_Position=1237; Antisense; GGTGAACTCTTGAGCGACGCCCTGA
>probe:Drosophila_2:1638021_at:352:283; Interrogation_Position=1258; Antisense; CTGATTGGAGTGTCCTTCCATCGAT
>probe:Drosophila_2:1638021_at:403:43; Interrogation_Position=1277; Antisense; ATCGATTTCTTCAACTGATGTCCCC
>probe:Drosophila_2:1638021_at:482:157; Interrogation_Position=1306; Antisense; ACACCCATTTACACATATCTGTTCC
>probe:Drosophila_2:1638021_at:413:19; Interrogation_Position=1320; Antisense; ATATCTGTTCCGTTACAAGGGTAGA
>probe:Drosophila_2:1638021_at:100:235; Interrogation_Position=1360; Antisense; AATCCCGATAACCAGCAAACCATAG
>probe:Drosophila_2:1638021_at:211:473; Interrogation_Position=1390; Antisense; GTTCACCATGACGAGCTAATATATT
>probe:Drosophila_2:1638021_at:413:557; Interrogation_Position=1426; Antisense; GGACTTTTGATTCCTTTGTTGAAGC
>probe:Drosophila_2:1638021_at:37:395; Interrogation_Position=1548; Antisense; GAAAGGTCTGAATTGGCCGCTATAC
>probe:Drosophila_2:1638021_at:89:579; Interrogation_Position=1562; Antisense; GGCCGCTATACAACGCGCAAGATAA
>probe:Drosophila_2:1638021_at:75:237; Interrogation_Position=1622; Antisense; AATCTGGCGGTTTCTTTTTGAATCG
>probe:Drosophila_2:1638021_at:393:543; Interrogation_Position=1662; Antisense; GGATTTATTTCCACTTTCAAGCTTT
>probe:Drosophila_2:1638021_at:298:255; Interrogation_Position=1737; Antisense; CAAACCCCTTACTCAATGCTAATTT

Paste this into a BLAST search page for me
GCTGGAGTACCCGAAATCACTTAAGGGTGAACTCTTGAGCGACGCCCTGACTGATTGGAGTGTCCTTCCATCGATATCGATTTCTTCAACTGATGTCCCCACACCCATTTACACATATCTGTTCCATATCTGTTCCGTTACAAGGGTAGAAATCCCGATAACCAGCAAACCATAGGTTCACCATGACGAGCTAATATATTGGACTTTTGATTCCTTTGTTGAAGCGAAAGGTCTGAATTGGCCGCTATACGGCCGCTATACAACGCGCAAGATAAAATCTGGCGGTTTCTTTTTGAATCGGGATTTATTTCCACTTTCAAGCTTTCAAACCCCTTACTCAATGCTAATTT

Full Affymetrix probeset data:

Annotations for 1638021_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720