Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638022_at:

>probe:Drosophila_2:1638022_at:675:31; Interrogation_Position=3362; Antisense; ATAACGAGCGCTCGCAAGCGACCGA
>probe:Drosophila_2:1638022_at:411:463; Interrogation_Position=3385; Antisense; GATTCCCTATCACCACAAGGCGAAC
>probe:Drosophila_2:1638022_at:30:437; Interrogation_Position=3425; Antisense; GAGGATGCCTCTAGTTGCTGCTCCA
>probe:Drosophila_2:1638022_at:379:637; Interrogation_Position=3518; Antisense; TCGATGGCCGCCTTCTGAGTGTTAA
>probe:Drosophila_2:1638022_at:592:715; Interrogation_Position=3530; Antisense; TTCTGAGTGTTAACCGCGTCGCTGC
>probe:Drosophila_2:1638022_at:502:483; Interrogation_Position=3612; Antisense; GTAGTCACCTCCTCTAGTCAGAATC
>probe:Drosophila_2:1638022_at:489:621; Interrogation_Position=3658; Antisense; TGCGCATTTAACTTGTTTTACACTG
>probe:Drosophila_2:1638022_at:115:699; Interrogation_Position=3674; Antisense; TTTACACTGCATTCCGTAGCCCTAA
>probe:Drosophila_2:1638022_at:711:673; Interrogation_Position=3690; Antisense; TAGCCCTAAGTTAGTCATCTGCCCA
>probe:Drosophila_2:1638022_at:210:643; Interrogation_Position=3707; Antisense; TCTGCCCATGAATTTACTAGCGAAA
>probe:Drosophila_2:1638022_at:287:325; Interrogation_Position=3726; Antisense; GCGAAATTATATTGTAGCGCCGATA
>probe:Drosophila_2:1638022_at:697:31; Interrogation_Position=3759; Antisense; ATAATTCTCGTTTGTAAGCCTTTGC
>probe:Drosophila_2:1638022_at:414:315; Interrogation_Position=3776; Antisense; GCCTTTGCTCGATTATTTGCTAGTT
>probe:Drosophila_2:1638022_at:134:693; Interrogation_Position=3791; Antisense; TTTGCTAGTTCTAAGCTGCGTTTTA

Paste this into a BLAST search page for me
ATAACGAGCGCTCGCAAGCGACCGAGATTCCCTATCACCACAAGGCGAACGAGGATGCCTCTAGTTGCTGCTCCATCGATGGCCGCCTTCTGAGTGTTAATTCTGAGTGTTAACCGCGTCGCTGCGTAGTCACCTCCTCTAGTCAGAATCTGCGCATTTAACTTGTTTTACACTGTTTACACTGCATTCCGTAGCCCTAATAGCCCTAAGTTAGTCATCTGCCCATCTGCCCATGAATTTACTAGCGAAAGCGAAATTATATTGTAGCGCCGATAATAATTCTCGTTTGTAAGCCTTTGCGCCTTTGCTCGATTATTTGCTAGTTTTTGCTAGTTCTAAGCTGCGTTTTA

Full Affymetrix probeset data:

Annotations for 1638022_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime