FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638026_at:

>probe:Drosophila_2:1638026_at:120:559; Interrogation_Position=1017; Antisense; GGAAGAGCTAGCCTTTCGGTATGCC
>probe:Drosophila_2:1638026_at:142:573; Interrogation_Position=1047; Antisense; GGCTGGCTACGCGAAAGTATTCCTG
>probe:Drosophila_2:1638026_at:446:481; Interrogation_Position=1063; Antisense; GTATTCCTGGACACATATCCGGTGG
>probe:Drosophila_2:1638026_at:173:163; Interrogation_Position=1095; Antisense; AAACTTGGAGTTCTTCACCACGGCG
>probe:Drosophila_2:1638026_at:702:563; Interrogation_Position=1138; Antisense; GGAATACCCATTAGTTCGCTGGCTT
>probe:Drosophila_2:1638026_at:533:287; Interrogation_Position=1156; Antisense; CTGGCTTTCTGTTTGGAGCTCTTTA
>probe:Drosophila_2:1638026_at:496:553; Interrogation_Position=1170; Antisense; GGAGCTCTTTATCCATCGACGAAAG
>probe:Drosophila_2:1638026_at:715:577; Interrogation_Position=663; Antisense; GGCCTTCGACATGAAGCCGGTGTTT
>probe:Drosophila_2:1638026_at:224:41; Interrogation_Position=713; Antisense; ATCTGATCCACTCGAGACTGCGCAT
>probe:Drosophila_2:1638026_at:435:705; Interrogation_Position=740; Antisense; TTATCCACGACTCGCTGCTGGAAGA
>probe:Drosophila_2:1638026_at:327:309; Interrogation_Position=834; Antisense; CCAGGATGCCTGGTTGTTCTTCAAC
>probe:Drosophila_2:1638026_at:95:115; Interrogation_Position=863; Antisense; AGCAGAAGGTGCTCATCCAGCCGTA
>probe:Drosophila_2:1638026_at:597:489; Interrogation_Position=885; Antisense; GTACTTTCATCTGTCCAAGGTGTGC
>probe:Drosophila_2:1638026_at:520:117; Interrogation_Position=952; Antisense; AGCTTTGCCGACTCACTGAACAAGT

Paste this into a BLAST search page for me
GGAAGAGCTAGCCTTTCGGTATGCCGGCTGGCTACGCGAAAGTATTCCTGGTATTCCTGGACACATATCCGGTGGAAACTTGGAGTTCTTCACCACGGCGGGAATACCCATTAGTTCGCTGGCTTCTGGCTTTCTGTTTGGAGCTCTTTAGGAGCTCTTTATCCATCGACGAAAGGGCCTTCGACATGAAGCCGGTGTTTATCTGATCCACTCGAGACTGCGCATTTATCCACGACTCGCTGCTGGAAGACCAGGATGCCTGGTTGTTCTTCAACAGCAGAAGGTGCTCATCCAGCCGTAGTACTTTCATCTGTCCAAGGTGTGCAGCTTTGCCGACTCACTGAACAAGT

Full Affymetrix probeset data:

Annotations for 1638026_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720