FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638028_at:

>probe:Drosophila_2:1638028_at:340:509; Interrogation_Position=2523; Antisense; GTGCACAGATTACTTGCTCACCTCA
>probe:Drosophila_2:1638028_at:429:195; Interrogation_Position=2553; Antisense; AACTGAGTCACAAAATCCGGGCATA
>probe:Drosophila_2:1638028_at:517:565; Interrogation_Position=2572; Antisense; GGCATACGTCGAGGATTGGTTACAT
>probe:Drosophila_2:1638028_at:268:131; Interrogation_Position=2617; Antisense; ACCGAACTAAGTGATCCCTGTGTGA
>probe:Drosophila_2:1638028_at:678:665; Interrogation_Position=2670; Antisense; TACAGAACATTGTCCCATGCACAGG
>probe:Drosophila_2:1638028_at:575:453; Interrogation_Position=2695; Antisense; GATAAGAACTACTCACGGTCACGAA
>probe:Drosophila_2:1638028_at:338:675; Interrogation_Position=2732; Antisense; TAGCTCGTTGTTGCGATGACTCCGA
>probe:Drosophila_2:1638028_at:569:9; Interrogation_Position=2831; Antisense; ATTCTTCACGAAGGCAACGCTACAC
>probe:Drosophila_2:1638028_at:54:279; Interrogation_Position=2850; Antisense; CTACACAGCGCACAATTTTCCAAAA
>probe:Drosophila_2:1638028_at:537:179; Interrogation_Position=2873; Antisense; AAAACATGCCTTCCAAACTCGAAAG
>probe:Drosophila_2:1638028_at:216:361; Interrogation_Position=2972; Antisense; GCAAGCCGACTGTCAAGTGGCCATA
>probe:Drosophila_2:1638028_at:158:523; Interrogation_Position=2988; Antisense; GTGGCCATACCATGTTTATACTAAT
>probe:Drosophila_2:1638028_at:619:65; Interrogation_Position=3011; Antisense; ATGGATTACCACCTGACATGCGGAC
>probe:Drosophila_2:1638028_at:65:623; Interrogation_Position=3029; Antisense; TGCGGACTAGCATACCTCATATACT

Paste this into a BLAST search page for me
GTGCACAGATTACTTGCTCACCTCAAACTGAGTCACAAAATCCGGGCATAGGCATACGTCGAGGATTGGTTACATACCGAACTAAGTGATCCCTGTGTGATACAGAACATTGTCCCATGCACAGGGATAAGAACTACTCACGGTCACGAATAGCTCGTTGTTGCGATGACTCCGAATTCTTCACGAAGGCAACGCTACACCTACACAGCGCACAATTTTCCAAAAAAAACATGCCTTCCAAACTCGAAAGGCAAGCCGACTGTCAAGTGGCCATAGTGGCCATACCATGTTTATACTAATATGGATTACCACCTGACATGCGGACTGCGGACTAGCATACCTCATATACT

Full Affymetrix probeset data:

Annotations for 1638028_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720