FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638030_at:

>probe:Drosophila_2:1638030_at:269:421; Interrogation_Position=126; Antisense; GAGCAACTGGCGAGAGTCCCTTAAG
>probe:Drosophila_2:1638030_at:199:659; Interrogation_Position=147; Antisense; TAAGACGGCCGGCACAGATCTGCAG
>probe:Drosophila_2:1638030_at:66:41; Interrogation_Position=164; Antisense; ATCTGCAGCCGCTGGGCAAAATGCT
>probe:Drosophila_2:1638030_at:131:171; Interrogation_Position=181; Antisense; AAAATGCTCACCATACCCGGAATTG
>probe:Drosophila_2:1638030_at:11:633; Interrogation_Position=194; Antisense; TACCCGGAATTGAGACCGACGACGA
>probe:Drosophila_2:1638030_at:49:139; Interrogation_Position=215; Antisense; ACGAGGATGCCAACGACGACAGCGA
>probe:Drosophila_2:1638030_at:94:327; Interrogation_Position=236; Antisense; GCGAGGACACGGACAGTCACGATGA
>probe:Drosophila_2:1638030_at:518:75; Interrogation_Position=263; Antisense; AGGATGACGAGACCAACGACCGCGT
>probe:Drosophila_2:1638030_at:371:327; Interrogation_Position=284; Antisense; GCGTCATCCCGGTAACCCAGGACTT
>probe:Drosophila_2:1638030_at:41:713; Interrogation_Position=326; Antisense; TTCAGATGAACGACGAGACCTCACC
>probe:Drosophila_2:1638030_at:674:649; Interrogation_Position=35; Antisense; TCAAAGTCTCCGTGGCCAATCGCTA
>probe:Drosophila_2:1638030_at:606:339; Interrogation_Position=56; Antisense; GCTACTGGTTGGACATGGCTCCTGC
>probe:Drosophila_2:1638030_at:501:335; Interrogation_Position=73; Antisense; GCTCCTGCCTCCGTAAACGAAGAAT
>probe:Drosophila_2:1638030_at:454:295; Interrogation_Position=90; Antisense; CGAAGAATCGCAGACGCGGCGTTAT

Paste this into a BLAST search page for me
GAGCAACTGGCGAGAGTCCCTTAAGTAAGACGGCCGGCACAGATCTGCAGATCTGCAGCCGCTGGGCAAAATGCTAAAATGCTCACCATACCCGGAATTGTACCCGGAATTGAGACCGACGACGAACGAGGATGCCAACGACGACAGCGAGCGAGGACACGGACAGTCACGATGAAGGATGACGAGACCAACGACCGCGTGCGTCATCCCGGTAACCCAGGACTTTTCAGATGAACGACGAGACCTCACCTCAAAGTCTCCGTGGCCAATCGCTAGCTACTGGTTGGACATGGCTCCTGCGCTCCTGCCTCCGTAAACGAAGAATCGAAGAATCGCAGACGCGGCGTTAT

Full Affymetrix probeset data:

Annotations for 1638030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720