FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638031_at:

>probe:Drosophila_2:1638031_at:96:337; Interrogation_Position=108; Antisense; GCTCTAATATCAACTGCATCCACGG
>probe:Drosophila_2:1638031_at:334:187; Interrogation_Position=155; Antisense; GAACCGGAAATGCACCAAACTCGTC
>probe:Drosophila_2:1638031_at:160:155; Interrogation_Position=25; Antisense; ACAGCTGTGTCTTGTTGTTTAACTA
>probe:Drosophila_2:1638031_at:90:101; Interrogation_Position=254; Antisense; AGAGCAGTACAATTTCCGGCCAAAT
>probe:Drosophila_2:1638031_at:584:523; Interrogation_Position=320; Antisense; GGGAGCCGGAACTTGCATGGATATA
>probe:Drosophila_2:1638031_at:479:399; Interrogation_Position=381; Antisense; GACACGCTCATGGACAATCATCAAC
>probe:Drosophila_2:1638031_at:698:195; Interrogation_Position=421; Antisense; AACTGGCCGCTGAAAACTATCTGTA
>probe:Drosophila_2:1638031_at:351:171; Interrogation_Position=453; Antisense; AAAGTTACCGACGTGGATGCCCAGC
>probe:Drosophila_2:1638031_at:658:673; Interrogation_Position=478; Antisense; TAGCTACTCTGGACTTTGAAGCCTT
>probe:Drosophila_2:1638031_at:422:19; Interrogation_Position=529; Antisense; ATCTTAGCAAATTCGTTTCCGCCAT
>probe:Drosophila_2:1638031_at:715:479; Interrogation_Position=543; Antisense; GTTTCCGCCATCAATCAGCTGATGT
>probe:Drosophila_2:1638031_at:286:607; Interrogation_Position=562; Antisense; TGATGTCCCATTGACTCCCAATAAG
>probe:Drosophila_2:1638031_at:496:367; Interrogation_Position=68; Antisense; GAACACTGTTTACATTACCGTTGGT
>probe:Drosophila_2:1638031_at:413:537; Interrogation_Position=90; Antisense; GGTACCACCAAATTCGATGCTCTAA

Paste this into a BLAST search page for me
GCTCTAATATCAACTGCATCCACGGGAACCGGAAATGCACCAAACTCGTCACAGCTGTGTCTTGTTGTTTAACTAAGAGCAGTACAATTTCCGGCCAAATGGGAGCCGGAACTTGCATGGATATAGACACGCTCATGGACAATCATCAACAACTGGCCGCTGAAAACTATCTGTAAAAGTTACCGACGTGGATGCCCAGCTAGCTACTCTGGACTTTGAAGCCTTATCTTAGCAAATTCGTTTCCGCCATGTTTCCGCCATCAATCAGCTGATGTTGATGTCCCATTGACTCCCAATAAGGAACACTGTTTACATTACCGTTGGTGGTACCACCAAATTCGATGCTCTAA

Full Affymetrix probeset data:

Annotations for 1638031_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720