FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638032_at:

>probe:Drosophila_2:1638032_at:706:679; Interrogation_Position=337; Antisense; TATGGCCTGAGATGTTCCAGAAGCT
>probe:Drosophila_2:1638032_at:321:567; Interrogation_Position=371; Antisense; GGCACTCATGCAGAAGCGCCTAGAG
>probe:Drosophila_2:1638032_at:147:101; Interrogation_Position=392; Antisense; AGAGATCGCCGACCTCATCGTGGAG
>probe:Drosophila_2:1638032_at:210:387; Interrogation_Position=435; Antisense; GAAAAGGCACTGGAACGTTACGATA
>probe:Drosophila_2:1638032_at:372:51; Interrogation_Position=507; Antisense; ATGCGCGAGCGTGTGAAGCAGTTCC
>probe:Drosophila_2:1638032_at:499:75; Interrogation_Position=532; Antisense; AGGAGAACTCGGTGCGCGAAGCTCT
>probe:Drosophila_2:1638032_at:165:379; Interrogation_Position=549; Antisense; GAAGCTCTGGTAGTGGATGTACGCA
>probe:Drosophila_2:1638032_at:175:323; Interrogation_Position=590; Antisense; GCCCAAGCCAGATACACTGCAGTAT
>probe:Drosophila_2:1638032_at:674:347; Interrogation_Position=608; Antisense; GCAGTATCCGCCATCGTCGGGAGGC
>probe:Drosophila_2:1638032_at:385:717; Interrogation_Position=679; Antisense; TTCGTGGCAGCGGACGGATCAACGT
>probe:Drosophila_2:1638032_at:334:543; Interrogation_Position=694; Antisense; GGATCAACGTAAACTTCACCACACA
>probe:Drosophila_2:1638032_at:299:51; Interrogation_Position=793; Antisense; ATGCGAATGTCCAGTCGCCGATGGA
>probe:Drosophila_2:1638032_at:448:475; Interrogation_Position=836; Antisense; GTTACATGTCAATTAGCGCGTGCGT
>probe:Drosophila_2:1638032_at:435:329; Interrogation_Position=853; Antisense; GCGTGCGTGCGAGACTGTGCTAATA

Paste this into a BLAST search page for me
TATGGCCTGAGATGTTCCAGAAGCTGGCACTCATGCAGAAGCGCCTAGAGAGAGATCGCCGACCTCATCGTGGAGGAAAAGGCACTGGAACGTTACGATAATGCGCGAGCGTGTGAAGCAGTTCCAGGAGAACTCGGTGCGCGAAGCTCTGAAGCTCTGGTAGTGGATGTACGCAGCCCAAGCCAGATACACTGCAGTATGCAGTATCCGCCATCGTCGGGAGGCTTCGTGGCAGCGGACGGATCAACGTGGATCAACGTAAACTTCACCACACAATGCGAATGTCCAGTCGCCGATGGAGTTACATGTCAATTAGCGCGTGCGTGCGTGCGTGCGAGACTGTGCTAATA

Full Affymetrix probeset data:

Annotations for 1638032_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720