FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638033_at:

>probe:Drosophila_2:1638033_at:164:505; Interrogation_Position=247; Antisense; GTGCGCCATGCCAGCTATCGGGATG
>probe:Drosophila_2:1638033_at:630:637; Interrogation_Position=289; Antisense; TCGTACTTCTTCAGCTGGGAGCATG
>probe:Drosophila_2:1638033_at:491:51; Interrogation_Position=347; Antisense; ATGCGAGGAACATCTGCCGCAGGCA
>probe:Drosophila_2:1638033_at:659:423; Interrogation_Position=394; Antisense; GAGACGCCACAGGAGAATGACTTTG
>probe:Drosophila_2:1638033_at:632:455; Interrogation_Position=449; Antisense; GATACATTTGGACCTCGGGCAGGAA
>probe:Drosophila_2:1638033_at:22:565; Interrogation_Position=470; Antisense; GGAAGTGCAACTTCGCTGGCTGCGA
>probe:Drosophila_2:1638033_at:461:615; Interrogation_Position=506; Antisense; TGCAGCCTCCCAATGAGAACGGTTG
>probe:Drosophila_2:1638033_at:173:95; Interrogation_Position=554; Antisense; AGATTGGACCCACTTCGCAGAGGAA
>probe:Drosophila_2:1638033_at:550:73; Interrogation_Position=574; Antisense; AGGAACACCGGCGATTGGTCTTCAA
>probe:Drosophila_2:1638033_at:214:465; Interrogation_Position=586; Antisense; GATTGGTCTTCAACGGGCGGATACC
>probe:Drosophila_2:1638033_at:31:103; Interrogation_Position=656; Antisense; AGAGCTGCCTGTCCATCCTGAACAA
>probe:Drosophila_2:1638033_at:684:159; Interrogation_Position=677; Antisense; ACAACTTCTACAACGATGGCATCAA
>probe:Drosophila_2:1638033_at:167:205; Interrogation_Position=730; Antisense; AAGCCATTTGTGTGCGAGGACTCCG
>probe:Drosophila_2:1638033_at:704:443; Interrogation_Position=754; Antisense; GATGAGCTGTTGAACTTCGTCCGCT

Paste this into a BLAST search page for me
GTGCGCCATGCCAGCTATCGGGATGTCGTACTTCTTCAGCTGGGAGCATGATGCGAGGAACATCTGCCGCAGGCAGAGACGCCACAGGAGAATGACTTTGGATACATTTGGACCTCGGGCAGGAAGGAAGTGCAACTTCGCTGGCTGCGATGCAGCCTCCCAATGAGAACGGTTGAGATTGGACCCACTTCGCAGAGGAAAGGAACACCGGCGATTGGTCTTCAAGATTGGTCTTCAACGGGCGGATACCAGAGCTGCCTGTCCATCCTGAACAAACAACTTCTACAACGATGGCATCAAAAGCCATTTGTGTGCGAGGACTCCGGATGAGCTGTTGAACTTCGTCCGCT

Full Affymetrix probeset data:

Annotations for 1638033_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720