FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638035_at:

>probe:Drosophila_2:1638035_at:492:81; Interrogation_Position=110; Antisense; AGGGACCCGGGAACATCTGCATACG
>probe:Drosophila_2:1638035_at:584:187; Interrogation_Position=121; Antisense; AACATCTGCATACGCGAGGAGCCAT
>probe:Drosophila_2:1638035_at:585:65; Interrogation_Position=13; Antisense; ATGGTTTTACCATTGGGATCAGGAC
>probe:Drosophila_2:1638035_at:417:75; Interrogation_Position=137; Antisense; AGGAGCCATATGTGGAGCACGTCCA
>probe:Drosophila_2:1638035_at:531:63; Interrogation_Position=146; Antisense; ATGTGGAGCACGTCCAGGTGCCAGA
>probe:Drosophila_2:1638035_at:546:629; Interrogation_Position=158; Antisense; TCCAGGTGCCAGAGATGCAGCCGGT
>probe:Drosophila_2:1638035_at:383:291; Interrogation_Position=184; Antisense; CGTGTGCGGACCTCCAGTTGGTGCA
>probe:Drosophila_2:1638035_at:612:93; Interrogation_Position=199; Antisense; AGTTGGTGCATGGAGATCCCGCCGA
>probe:Drosophila_2:1638035_at:27:591; Interrogation_Position=202; Antisense; TGGTGCATGGAGATCCCGCCGAGAT
>probe:Drosophila_2:1638035_at:297:319; Interrogation_Position=219; Antisense; GCCGAGATGCGCCACCTTCAAGACG
>probe:Drosophila_2:1638035_at:155:651; Interrogation_Position=236; Antisense; TCAAGACGGAAATGCGCGAGGTGAT
>probe:Drosophila_2:1638035_at:411:545; Interrogation_Position=28; Antisense; GGATCAGGACAAAACAGCACCCTCA
>probe:Drosophila_2:1638035_at:262:559; Interrogation_Position=34; Antisense; GGACAAAACAGCACCCTCAAGATCA
>probe:Drosophila_2:1638035_at:587:351; Interrogation_Position=44; Antisense; GCACCCTCAAGATCAACACAAACGT

Paste this into a BLAST search page for me
AGGGACCCGGGAACATCTGCATACGAACATCTGCATACGCGAGGAGCCATATGGTTTTACCATTGGGATCAGGACAGGAGCCATATGTGGAGCACGTCCAATGTGGAGCACGTCCAGGTGCCAGATCCAGGTGCCAGAGATGCAGCCGGTCGTGTGCGGACCTCCAGTTGGTGCAAGTTGGTGCATGGAGATCCCGCCGATGGTGCATGGAGATCCCGCCGAGATGCCGAGATGCGCCACCTTCAAGACGTCAAGACGGAAATGCGCGAGGTGATGGATCAGGACAAAACAGCACCCTCAGGACAAAACAGCACCCTCAAGATCAGCACCCTCAAGATCAACACAAACGT

Full Affymetrix probeset data:

Annotations for 1638035_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720