Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638036_at:

>probe:Drosophila_2:1638036_at:316:501; Interrogation_Position=330; Antisense; GTCGGATCGTCATGGAGCTGCGCTC
>probe:Drosophila_2:1638036_at:397:61; Interrogation_Position=357; Antisense; ATGTCGTGCCCAAGACCGCCGAGAA
>probe:Drosophila_2:1638036_at:351:543; Interrogation_Position=410; Antisense; GGATTCGGGTACAAGGGCTCCATTT
>probe:Drosophila_2:1638036_at:127:45; Interrogation_Position=446; Antisense; ATCCCCAACTTCATGTGCCAGGGCG
>probe:Drosophila_2:1638036_at:174:39; Interrogation_Position=509; Antisense; ATCTACGGCAACAAGTTCCCCGATG
>probe:Drosophila_2:1638036_at:611:469; Interrogation_Position=523; Antisense; GTTCCCCGATGAGAACTTCGAGCTG
>probe:Drosophila_2:1638036_at:605:191; Interrogation_Position=536; Antisense; AACTTCGAGCTGAAGCACACCGGCT
>probe:Drosophila_2:1638036_at:645:597; Interrogation_Position=570; Antisense; TGTCGATGGCCAACGCTGGCGCCAA
>probe:Drosophila_2:1638036_at:361:195; Interrogation_Position=599; Antisense; AACGGCTCCCAGTTCTTTATTTGCA
>probe:Drosophila_2:1638036_at:63:21; Interrogation_Position=617; Antisense; ATTTGCACTGTGAAGACCGCCTGGT
>probe:Drosophila_2:1638036_at:616:375; Interrogation_Position=628; Antisense; GAAGACCGCCTGGTTGGACAACAAG
>probe:Drosophila_2:1638036_at:675:43; Interrogation_Position=715; Antisense; ATCGCAGTCTGGCAAGACCTCCAAG
>probe:Drosophila_2:1638036_at:221:453; Interrogation_Position=742; Antisense; GATCATTGTGGCTAACTCTGGTTCT
>probe:Drosophila_2:1638036_at:502:571; Interrogation_Position=751; Antisense; GGCTAACTCTGGTTCTCTTTAAGAA

Paste this into a BLAST search page for me
GTCGGATCGTCATGGAGCTGCGCTCATGTCGTGCCCAAGACCGCCGAGAAGGATTCGGGTACAAGGGCTCCATTTATCCCCAACTTCATGTGCCAGGGCGATCTACGGCAACAAGTTCCCCGATGGTTCCCCGATGAGAACTTCGAGCTGAACTTCGAGCTGAAGCACACCGGCTTGTCGATGGCCAACGCTGGCGCCAAAACGGCTCCCAGTTCTTTATTTGCAATTTGCACTGTGAAGACCGCCTGGTGAAGACCGCCTGGTTGGACAACAAGATCGCAGTCTGGCAAGACCTCCAAGGATCATTGTGGCTAACTCTGGTTCTGGCTAACTCTGGTTCTCTTTAAGAA

Full Affymetrix probeset data:

Annotations for 1638036_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime